RPS3 cDNA ORF Clone, Human, untagged

Cat: HG16143-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RPS3 Reagents

CRO Services

Product recommended


All RPS3 Reagents

RPS3 cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Human ribosomal protein S3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS3 cDNA ORF Clone, Human, untagged Alternative Names

S3 cDNA ORF Clone, Human

RPS3 Background Information

Full Name
ribosomal protein S3

RPS3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS3 cDNA ORF Clone in Cloning Vector, Rat RG81300-G
RPS3 cDNA ORF Clone, Rat, untagged RG81300-UT
RPS3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81300-ACGLN
RPS3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81300-ACG
RPS3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81300-ANG
RPS3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81300-ACR
RPS3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81300-ANR
RPS3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81300-CF
RPS3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81300-NF
RPS3 cDNA ORF Clone, Rat, C-His tag RG81300-CH
RPS3 cDNA ORF Clone, Rat, N-His tag RG81300-NH
RPS3 cDNA ORF Clone, Rat, C-HA tag RG81300-CY
RPS3 cDNA ORF Clone, Rat, N-HA tag RG81300-NY
RPS3 cDNA ORF Clone, Rat, C-Myc tag RG81300-CM
RPS3 cDNA ORF Clone, Rat, N-Myc tag RG81300-NM
RPS3 qPCR Primer Pairs, Rat RP301256

RPS3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS3 cDNA ORF Clone in Cloning Vector, Mouse MG51677-G
RPS3 cDNA ORF Clone, Mouse, untagged MG51677-UT
RPS3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51677-ACG
RPS3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51677-ACGLN
RPS3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51677-ANG
RPS3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51677-ACR
RPS3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51677-ANR
RPS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51677-CF
RPS3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51677-NF
RPS3 cDNA ORF Clone, Mouse, C-His tag MG51677-CH
RPS3 cDNA ORF Clone, Mouse, N-His tag MG51677-NH
RPS3 cDNA ORF Clone, Mouse, C-HA tag MG51677-CY
RPS3 cDNA ORF Clone, Mouse, N-HA tag MG51677-NY
RPS3 cDNA ORF Clone, Mouse, C-Myc tag MG51677-CM
RPS3 cDNA ORF Clone, Mouse, N-Myc tag MG51677-NM
RPS3 qPCR Primer Pairs, Mouse MP201550

RPS3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS3 cDNA ORF Clone in Cloning Vector, Human HG16143-G
RPS3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16143-ACG
RPS3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16143-ACGLN
RPS3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16143-ANG
RPS3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16143-ACR
RPS3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16143-ANR
RPS3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16143-CF
RPS3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16143-NF
RPS3 cDNA ORF Clone, Human, C-His tag HG16143-CH
RPS3 cDNA ORF Clone, Human, N-His tag HG16143-NH
RPS3 cDNA ORF Clone, Human, C-HA tag HG16143-CY
RPS3 cDNA ORF Clone, Human, N-HA tag HG16143-NY
RPS3 cDNA ORF Clone, Human, C-Myc tag HG16143-CM
RPS3 cDNA ORF Clone, Human, N-Myc tag HG16143-NM
RPS3 qPCR Primer Pairs, Human HP104913
info info
添加购物车成功! 添加购物车失败!