RPRM cDNA ORF Clone, Human, N-His tag

Cat: HG14923-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPRM Reagents
CRO Services
Product recommended

All RPRM Reagents
RPRM cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
330 bp
Description
Full length Clone DNA of Human reprimo, TP53 dependent G2 arrest mediator candidate with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPRM cDNA ORF Clone, Human, N-His tag Alternative Names
REPRIMO cDNA ORF Clone, Human
RPRM Background Information
Full Name
reprimo, TP53 dependent G2 arrest mediator candidate

RPRM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPRM cDNA ORF Clone in Cloning Vector, Mouse MG5A0925-U
RPRM cDNA ORF Clone, Mouse, untagged MG5A0925-UT
RPRM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0925-ACGLN
RPRM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0925-ACG
RPRM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0925-ANG
RPRM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0925-ACR
RPRM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0925-ANR
RPRM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0925-CF
RPRM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0925-NF
RPRM cDNA ORF Clone, Mouse, C-His tag MG5A0925-CH
RPRM cDNA ORF Clone, Mouse, N-His tag MG5A0925-NH
RPRM cDNA ORF Clone, Mouse, C-HA tag MG5A0925-CY
RPRM cDNA ORF Clone, Mouse, N-HA tag MG5A0925-NY
RPRM cDNA ORF Clone, Mouse, C-Myc tag MG5A0925-CM
RPRM cDNA ORF Clone, Mouse, N-Myc tag MG5A0925-NM

RPRM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPRM cDNA ORF Clone in Cloning Vector, Human HG14923-G
RPRM cDNA ORF Clone, Human, untagged HG14923-UT
RPRM cDNA ORF Clone, Human, C-GFPSpark® tag HG14923-ACG
RPRM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14923-ACGLN
RPRM cDNA ORF Clone, Human, N-GFPSpark® tag HG14923-ANG
RPRM cDNA ORF Clone, Human, C-OFPSpark® tag HG14923-ACR
RPRM cDNA ORF Clone, Human, N-OFPSpark® tag HG14923-ANR
RPRM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14923-CF
RPRM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14923-NF
RPRM cDNA ORF Clone, Human, C-His tag HG14923-CH
RPRM cDNA ORF Clone, Human, C-HA tag HG14923-CY
RPRM cDNA ORF Clone, Human, N-HA tag HG14923-NY
RPRM cDNA ORF Clone, Human, C-Myc tag HG14923-CM
RPRM cDNA ORF Clone, Human, N-Myc tag HG14923-NM
RPRM qPCR Primer Pairs, Human HP103552
info info
添加购物车成功! 添加购物车失败!