RPRD1B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14027-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPRD1B Reagents
CRO Services
Product recommended

All RPRD1B Reagents
RPRD1B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
981 bp
Description
Full length Clone DNA of Human regulation of nuclear pre-mRNA domain containing 1B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPRD1B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
C20orf77 cDNA ORF Clone, Human;CREPT cDNA ORF Clone, Human;dJ1057B20.2 cDNA ORF Clone, Human;NET60 cDNA ORF Clone, Human
RPRD1B Background Information

RPRD1B, together with RPRD1A, can accompany RNAP II from promoter regions to 3'-untranslated regions during transcription in vivo, predominantly interact with phosphorylated RNAP II, and can reduce CTD S5- and S7-phosphorylated RNAP II at target gene promoters. RNA polymerase II C-terminal domain (CTD) phosphorylation is important for various transcription-related processes. RPRD1B is a transcriptional regulator which enhances expression of CCND1. It also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A.

Full Name
regulation of nuclear pre-mRNA domain containing 1B
References
  • Ni Z. et al., 2011, Transcription. 2 (5): 237-42.
  • Kristensen AR. et al., 2012, Nat Methods. 9 (9): 907-9.
  • Woods NT. et al., 2012, Sci Signal.5 (242): rs6.
  • RPRD1B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RPRD1B cDNA ORF Clone in Cloning Vector, Mouse MG53089-G
    RPRD1B cDNA ORF Clone, Mouse, untagged MG53089-UT
    RPRD1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53089-ACGLN
    RPRD1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53089-ACG
    RPRD1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53089-ANG
    RPRD1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53089-ACR
    RPRD1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53089-ANR
    RPRD1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53089-CF
    RPRD1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53089-NF
    RPRD1B cDNA ORF Clone, Mouse, C-His tag MG53089-CH
    RPRD1B cDNA ORF Clone, Mouse, N-His tag MG53089-NH
    RPRD1B cDNA ORF Clone, Mouse, C-HA tag MG53089-CY
    RPRD1B cDNA ORF Clone, Mouse, N-HA tag MG53089-NY
    RPRD1B cDNA ORF Clone, Mouse, C-Myc tag MG53089-CM
    RPRD1B cDNA ORF Clone, Mouse, N-Myc tag MG53089-NM

    RPRD1B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RPRD1B cDNA ORF Clone in Cloning Vector, Human HG14027-G
    RPRD1B cDNA ORF Clone, Human, untagged HG14027-UT
    RPRD1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14027-ACGLN
    RPRD1B cDNA ORF Clone, Human, C-GFPSpark® tag HG14027-ACG
    RPRD1B cDNA ORF Clone, Human, N-GFPSpark® tag HG14027-ANG
    RPRD1B cDNA ORF Clone, Human, C-OFPSpark® tag HG14027-ACR
    RPRD1B cDNA ORF Clone, Human, N-OFPSpark® tag HG14027-ANR
    RPRD1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14027-CF
    RPRD1B cDNA ORF Clone, Human, C-His tag HG14027-CH
    RPRD1B cDNA ORF Clone, Human, N-His tag HG14027-NH
    RPRD1B cDNA ORF Clone, Human, C-HA tag HG14027-CY
    RPRD1B cDNA ORF Clone, Human, N-HA tag HG14027-NY
    RPRD1B cDNA ORF Clone, Human, C-Myc tag HG14027-CM
    RPRD1B cDNA ORF Clone, Human, N-Myc tag HG14027-NM
    RPRD1B qPCR Primer Pairs, Human HP102683
    info info
    添加购物车成功! 添加购物车失败!