Ribophorin II cDNA ORF Clone, Human, N-Myc tag

Cat: HG15014-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ribophorin II Reagents
CRO Services
Product recommended

All Ribophorin II Reagents
Ribophorin II cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Human ribophorin II with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ribophorin II cDNA ORF Clone, Human, N-Myc tag Alternative Names
RIBIIR cDNA ORF Clone, Human;RPN-II cDNA ORF Clone, Human;RPNII cDNA ORF Clone, Human;SWP1 cDNA ORF Clone, Human
Ribophorin II Background Information
Full Name
ribophorin II

Ribophorin II cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Ribophorin II cDNA ORF Clone in Cloning Vector, Mouse MG53902-U
Ribophorin II cDNA ORF Clone, Mouse, untagged MG53902-UT
Ribophorin II Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53902-ACGLN
Ribophorin II cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53902-ACG
Ribophorin II cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53902-ACR
Ribophorin II cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53902-CF
Ribophorin II cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53902-NF
Ribophorin II cDNA ORF Clone, Mouse, C-His tag MG53902-CH
Ribophorin II cDNA ORF Clone, Mouse, N-His tag MG53902-NH
Ribophorin II cDNA ORF Clone, Mouse, C-HA tag MG53902-CY
Ribophorin II cDNA ORF Clone, Mouse, N-HA tag MG53902-NY
Ribophorin II cDNA ORF Clone, Mouse, C-Myc tag MG53902-CM
Ribophorin II cDNA ORF Clone, Mouse, N-Myc tag MG53902-NM

Ribophorin II cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Ribophorin II cDNA ORF Clone in Cloning Vector, Human HG15014-G
Ribophorin II cDNA ORF Clone, Human, untagged HG15014-UT
Ribophorin II Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15014-ACGLN
Ribophorin II cDNA ORF Clone, Human, C-GFPSpark® tag HG15014-ACG
Ribophorin II cDNA ORF Clone, Human, C-OFPSpark® tag HG15014-ACR
Ribophorin II cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15014-CF
Ribophorin II cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15014-NF
Ribophorin II cDNA ORF Clone, Human, C-His tag HG15014-CH
Ribophorin II cDNA ORF Clone, Human, N-His tag HG15014-NH
Ribophorin II cDNA ORF Clone, Human, C-HA tag HG15014-CY
Ribophorin II cDNA ORF Clone, Human, N-HA tag HG15014-NY
Ribophorin II cDNA ORF Clone, Human, C-Myc tag HG15014-CM
Ribophorin II qPCR Primer Pairs, Human HP103642
info info
添加购物车成功! 添加购物车失败!