RPL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG16351-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPL3 Reagents
CRO Services
Product recommended

All RPL3 Reagents
RPL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Human ribosomal protein L3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL3 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ASC-1 cDNA ORF Clone, Human;L3 cDNA ORF Clone, Human;TARBP-B cDNA ORF Clone, Human
RPL3 Background Information
Full Name
ribosomal protein L3

RPL3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RPL3 cDNA ORF Clone in Cloning Vector, Rhesus CG90627-G
RPL3 cDNA ORF Clone, Rhesus, untagged CG90627-UT
RPL3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90627-ACG
RPL3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90627-ACGLN
RPL3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90627-ANG
RPL3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90627-ACR
RPL3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90627-ANR
RPL3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90627-CF
RPL3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90627-NF
RPL3 cDNA ORF Clone, Rhesus, C-His tag CG90627-CH
RPL3 cDNA ORF Clone, Rhesus, N-His tag CG90627-NH
RPL3 cDNA ORF Clone, Rhesus, C-HA tag CG90627-CY
RPL3 cDNA ORF Clone, Rhesus, N-HA tag CG90627-NY
RPL3 cDNA ORF Clone, Rhesus, C-Myc tag CG90627-CM
RPL3 cDNA ORF Clone, Rhesus, N-Myc tag CG90627-NM

RPL3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPL3 cDNA ORF Clone in Cloning Vector, Rat RG80769-U
RPL3 cDNA ORF Clone, Rat, untagged RG80769-UT
RPL3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80769-ACGLN
RPL3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80769-ACG
RPL3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80769-ANG
RPL3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80769-ACR
RPL3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80769-ANR
RPL3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80769-CF
RPL3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80769-NF
RPL3 cDNA ORF Clone, Rat, C-His tag RG80769-CH
RPL3 cDNA ORF Clone, Rat, N-His tag RG80769-NH
RPL3 cDNA ORF Clone, Rat, C-HA tag RG80769-CY
RPL3 cDNA ORF Clone, Rat, N-HA tag RG80769-NY
RPL3 cDNA ORF Clone, Rat, C-Myc tag RG80769-CM
RPL3 cDNA ORF Clone, Rat, N-Myc tag RG80769-NM
RPL3 qPCR Primer Pairs, Rat RP300733

RPL3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL3 cDNA ORF Clone in Cloning Vector, Mouse MG53478-G
RPL3 cDNA ORF Clone, Mouse, untagged MG53478-UT
RPL3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53478-ACGLN
RPL3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53478-ACG
RPL3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53478-ANG
RPL3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53478-ACR
RPL3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53478-ANR
RPL3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53478-CF
RPL3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53478-NF
RPL3 cDNA ORF Clone, Mouse, C-His tag MG53478-CH
RPL3 cDNA ORF Clone, Mouse, N-His tag MG53478-NH
RPL3 cDNA ORF Clone, Mouse, C-HA tag MG53478-CY
RPL3 cDNA ORF Clone, Mouse, N-HA tag MG53478-NY
RPL3 cDNA ORF Clone, Mouse, C-Myc tag MG53478-CM
RPL3 cDNA ORF Clone, Mouse, N-Myc tag MG53478-NM

RPL3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL3 cDNA ORF Clone in Cloning Vector, Human HG16351-G
RPL3 cDNA ORF Clone, Human, untagged HG16351-UT
RPL3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16351-ACG
RPL3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16351-ACGLN
RPL3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16351-ANG
RPL3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16351-ACR
RPL3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16351-ANR
RPL3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16351-NF
RPL3 cDNA ORF Clone, Human, C-His tag HG16351-CH
RPL3 cDNA ORF Clone, Human, N-His tag HG16351-NH
RPL3 cDNA ORF Clone, Human, C-HA tag HG16351-CY
RPL3 cDNA ORF Clone, Human, N-HA tag HG16351-NY
RPL3 cDNA ORF Clone, Human, C-Myc tag HG16351-CM
RPL3 cDNA ORF Clone, Human, N-Myc tag HG16351-NM
RPL3 qPCR Primer Pairs, Human HP105103
info info
添加购物车成功! 添加购物车失败!