RPL23A cDNA ORF Clone, Human, N-Myc tag

Cat: HG16234-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPL23A Reagents
CRO Services
Product recommended

All RPL23A Reagents
RPL23A cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
471 bp
Description
Full length Clone DNA of Human ribosomal protein L23a with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPL23A cDNA ORF Clone, Human, N-Myc tag Alternative Names
L23A cDNA ORF Clone, Human;MDA20 cDNA ORF Clone, Human
RPL23A Background Information
Full Name
ribosomal protein L23a

RPL23A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPL23A cDNA ORF Clone in Cloning Vector, Mouse MG53431-U
RPL23A cDNA ORF Clone, Mouse, untagged MG53431-UT
RPL23A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53431-ACGLN
RPL23A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53431-ACG
RPL23A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53431-ANG
RPL23A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53431-ACR
RPL23A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53431-ANR
RPL23A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53431-CF
RPL23A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53431-NF
RPL23A cDNA ORF Clone, Mouse, C-His tag MG53431-CH
RPL23A cDNA ORF Clone, Mouse, N-His tag MG53431-NH
RPL23A cDNA ORF Clone, Mouse, C-HA tag MG53431-CY
RPL23A cDNA ORF Clone, Mouse, N-HA tag MG53431-NY
RPL23A cDNA ORF Clone, Mouse, C-Myc tag MG53431-CM
RPL23A cDNA ORF Clone, Mouse, N-Myc tag MG53431-NM

RPL23A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPL23A cDNA ORF Clone in Cloning Vector, Human HG16234-G
RPL23A cDNA ORF Clone, Human, untagged HG16234-UT
RPL23A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16234-ACGLN
RPL23A cDNA ORF Clone, Human, C-GFPSpark® tag HG16234-ACG
RPL23A cDNA ORF Clone, Human, N-GFPSpark® tag HG16234-ANG
RPL23A cDNA ORF Clone, Human, C-OFPSpark® tag HG16234-ACR
RPL23A cDNA ORF Clone, Human, N-OFPSpark® tag HG16234-ANR
RPL23A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16234-CF
RPL23A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16234-NF
RPL23A cDNA ORF Clone, Human, C-His tag HG16234-CH
RPL23A cDNA ORF Clone, Human, N-His tag HG16234-NH
RPL23A cDNA ORF Clone, Human, C-HA tag HG16234-CY
RPL23A cDNA ORF Clone, Human, N-HA tag HG16234-NY
RPL23A cDNA ORF Clone, Human, C-Myc tag HG16234-CM
RPL23A qPCR Primer Pairs, Human HP104998
info info
添加购物车成功! 添加购物车失败!