RPA2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11571-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPA2 Reagents
CRO Services
Product recommended

All RPA2 Reagents
RPA2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
813 bp
Description
Full length Clone DNA of Human replication protein A2, 32kDa with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPA2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
REPA2 cDNA ORF Clone, Human;RP-A p32 cDNA ORF Clone, Human;RP-A p34 cDNA ORF Clone, Human;RPA32 cDNA ORF Clone, Human
RPA2 Background Information
Full Name
replication protein A2

RPA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPA2 cDNA ORF Clone in Cloning Vector, Mouse MG5A1337-U
RPA2 cDNA ORF Clone, Mouse, untagged MG5A1337-UT
RPA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1337-ACGLN
RPA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1337-ACG
RPA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1337-ANG
RPA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1337-ACR
RPA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1337-ANR
RPA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1337-CF
RPA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1337-NF
RPA2 cDNA ORF Clone, Mouse, C-His tag MG5A1337-CH
RPA2 cDNA ORF Clone, Mouse, N-His tag MG5A1337-NH
RPA2 cDNA ORF Clone, Mouse, C-HA tag MG5A1337-CY
RPA2 cDNA ORF Clone, Mouse, N-HA tag MG5A1337-NY
RPA2 cDNA ORF Clone, Mouse, C-Myc tag MG5A1337-CM
RPA2 cDNA ORF Clone, Mouse, N-Myc tag MG5A1337-NM

RPA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPA2 cDNA ORF Clone in Cloning Vector, Human HG11571-M
RPA2 cDNA ORF Clone, Human, untagged HG11571-UT
RPA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11571-ACG
RPA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11571-ACGLN
RPA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11571-ANG
RPA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11571-ACR
RPA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11571-ANR
RPA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11571-CF
RPA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11571-NF
RPA2 cDNA ORF Clone, Human, C-His tag HG11571-CH
RPA2 cDNA ORF Clone, Human, N-His tag HG11571-NH
RPA2 cDNA ORF Clone, Human, C-HA tag HG11571-CY
RPA2 cDNA ORF Clone, Human, N-HA tag HG11571-NY
RPA2 cDNA ORF Clone, Human, C-Myc tag HG11571-CM
RPA2 qPCR Primer Pairs, Human HP101433
info info
添加购物车成功! 添加购物车失败!