Quick Order

Text Size:AAA

Human RP2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human RP2 cDNA Clone Product Information
NCBI RefSeq:NM_006915.2
RefSeq ORF Size:1053bp
cDNA Description:Full length Clone DNA of Homo sapiens retinitis pigmentosa 2 (X-linked recessive) with C terminal Myc tag.
Gene Synonym:TBCCD2, KIAA0215
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RP2 qPCR primers for gene expression analysis, HP100611 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

XRP2, also known as Protein XRP2 and RP2, is a member of the TBCC (tubulin cofactor C) family and contains one C-CAP/cofactor C-like domain. This protein is encoded by the RP2 gene in humans. XRP2 stimulates the GTPase activity of tubulin, but does not enhance tubulin heterodimerization. XRP2 acts as guanine nucleotide dissociation inhibitor for ARL3. Defects in RP2 gene are the cause of retinitis pigmentosa type 2 (RP2), also known as X-linked retinitis pigmentosa 2 (XLRP-2). It leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. 

Size / Price
Catalog: HG10637-CM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"