Quick Order

Text Size:AAA

Human RP2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human RP2 cDNA Clone Product Information
NCBI RefSeq:NM_006915.2
RefSeq ORF Size:1053bp
cDNA Description:Full length Clone DNA of Homo sapiens retinitis pigmentosa 2 (X-linked recessive) with C terminal HA tag.
Gene Synonym:TBCCD2, KIAA0215
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

XRP2, also known as Protein XRP2 and RP2, is a member of the TBCC (tubulin cofactor C) family and contains one C-CAP/cofactor C-like domain. This protein is encoded by the RP2 gene in humans. XRP2 stimulates the GTPase activity of tubulin, but does not enhance tubulin heterodimerization. XRP2 acts as guanine nucleotide dissociation inhibitor for ARL3. Defects in RP2 gene are the cause of retinitis pigmentosa type 2 (RP2), also known as X-linked retinitis pigmentosa 2 (XLRP-2). It leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. 

Size / Price
Catalog: HG10637-CY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"