Quick Order

Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human RORC cDNA Clone Product Information
NCBI RefSeq:NM_005060.3
RefSeq ORF Size:1557bp
cDNA Description:Full length Clone DNA of Homo sapiens RAR-related orphan receptor C , transcript variant 1.
Gene Synonym:TOR, RORG, RZRG, NR1F3, MGC129539, RZR-GAMMA, RORC
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid on other vectors
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10718-ACG$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10718-ACR$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10718-ANG$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10718-ANR$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10718-CF$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10718-CH$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10718-CM$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10718-CY$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10718-NF$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10718-NH$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10718-NM$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10718-NY$215
Human RORC transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10718-U$75
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10718-U-F$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmidHG10718-U-N$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmidHG10718-UT$215
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10718-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"