Quick Order

Text Size:AAA

Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human RORC cDNA Clone Product Information
NCBI RefSeq:NM_005060.3
RefSeq ORF Size:1557bp
cDNA Description:Full length Clone DNA of Homo sapiens RAR-related orphan receptor C , transcript variant 1 with C terminal Myc tag.
Gene Synonym:TOR, RORG, RZRG, NR1F3, MGC129539, RZR-GAMMA, RORC
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10718-ACG$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10718-ACR$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10718-ANG$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10718-ANR$245
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10718-CF$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10718-CH$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10718-CM$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10718-CY$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10718-NF$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10718-NH$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10718-NM$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10718-NY$215
Human RORC transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10718-U$75
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10718-U-F$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmidHG10718-U-N$215
Human RORC transcript variant 1 Gene ORF cDNA clone expression plasmidHG10718-UT$215
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"