RORA cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12101-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RORA Reagents
CRO Services
Product recommended

All RORA Reagents
RORA cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1572 bp
Description
Full length Clone DNA of Human RAR-related orphan receptor A with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RORA cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
NR1F1 cDNA ORF Clone, Human;ROR1 cDNA ORF Clone, Human;ROR2 cDNA ORF Clone, Human;ROR3 cDNA ORF Clone, Human;RZR-ALPHA cDNA ORF Clone, Human;RZRA cDNA ORF Clone, Human
RORA Background Information
Full Name
RAR-related orphan receptor A

RORA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RORA cDNA ORF Clone in Cloning Vector, Mouse MG57116-U
RORA cDNA ORF Clone, Mouse, untagged MG57116-UT
RORA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57116-ACGLN
RORA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57116-ACG
RORA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57116-ANG
RORA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57116-ACR
RORA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57116-ANR
RORA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57116-CF
RORA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57116-NF
RORA cDNA ORF Clone, Mouse, C-His tag MG57116-CH
RORA cDNA ORF Clone, Mouse, N-His tag MG57116-NH
RORA cDNA ORF Clone, Mouse, C-HA tag MG57116-CY
RORA cDNA ORF Clone, Mouse, N-HA tag MG57116-NY
RORA cDNA ORF Clone, Mouse, C-Myc tag MG57116-CM
RORA cDNA ORF Clone, Mouse, N-Myc tag MG57116-NM

RORA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RORA cDNA ORF Clone in Cloning Vector, Human HG12101-G
RORA cDNA ORF Clone, Human, untagged HG12101-G-N
RORA cDNA ORF Clone, Human, untagged HG12101-UT
RORA cDNA ORF Clone, Human, C-GFPSpark® tag HG12101-ACG
RORA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12101-ACGLN
RORA cDNA ORF Clone, Human, N-GFPSpark® tag HG12101-ANG
RORA cDNA ORF Clone, Human, C-OFPSpark® tag HG12101-ACR
RORA cDNA ORF Clone, Human, N-OFPSpark® tag HG12101-ANR
RORA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12101-G-F
RORA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12101-CF
RORA cDNA ORF Clone, Human, C-His tag HG12101-CH
RORA cDNA ORF Clone, Human, N-His tag HG12101-NH
RORA cDNA ORF Clone, Human, C-HA tag HG12101-CY
RORA cDNA ORF Clone, Human, N-HA tag HG12101-NY
RORA cDNA ORF Clone, Human, C-Myc tag HG12101-CM
RORA cDNA ORF Clone, Human, N-Myc tag HG12101-NM
RORA qPCR Primer Pairs, Human HP101629
info info
添加购物车成功! 添加购物车失败!