ROBO2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10310-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ROBO2 Reagents
CRO Services
Product recommended

All ROBO2 Reagents
ROBO2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
4137 bp
Description
Full length Clone DNA of Human roundabout, axon guidance receptor, homolog 2 (Drosophila), transcript variant 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ROBO2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
KIAA1568 cDNA ORF Clone, Human;ROBO2 cDNA ORF Clone, Human;SAX3 cDNA ORF Clone, Human
ROBO2 Background Information

ROBO2 belongs to the ROBO family. Members of the ROBO family are a group of highly conserved transmembrane glycoproteins that make up a small subgroup of the immunoglobulin (Ig) superfamily. They are best known for their roles as receptors for the Slit family of repellent axon guidance cues. In structure, ROBOs are characterized by five C2-type Ig-like repeats, three fibronectin type III domains, a transmembrane region, and an intracellular domain with three (ROBO3) or four (ROBO1, 2) CC (conserved cytoplasmic) motifs. ROBO2 is a receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development. ROBO2 also abrogates SLIT-ROBO signaling in vitro.

Full Name
roundabout homolog 2 (Drosophila)
References
  • Brose K, et al. (1999) Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96(6):795-806.
  • Brose K, et al. (1999) Slit2-Mediated chemorepulsion and collapse of developing forebrain axons. Neuron. 22(3):463-73.
  • Nagase T, et al. (2001) Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 7(4):273-81.
  • info info
    添加购物车成功! 添加购物车失败!