After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ROBO2 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human ROBO2 cDNA Clone Product Information
NCBI RefSeq:NM_002942.4
RefSeq ORF Size:4137bp
cDNA Description:Full length Clone DNA of Homo sapiens roundabout, axon guidance receptor, homolog 2 (Drosophila), transcript variant 2 with N terminal Myc tag.
Gene Synonym:SAX3, KIAA1568
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ROBO2 belongs to the ROBO family. Members of the ROBO family are a group of highly conserved transmembrane glycoproteins that make up a small subgroup of the immunoglobulin (Ig) superfamily. They are best known for their roles as receptors for the Slit family of repellent axon guidance cues. In structure, ROBOs are characterized by five C2-type Ig-like repeats, three fibronectin type III domains, a transmembrane region, and an intracellular domain with three (ROBO3) or four (ROBO1, 2) CC (conserved cytoplasmic) motifs. ROBO2 is a receptor for SLIT2, and probably SLIT1, which are thought to act as molecular guidance cue in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development. ROBO2 also abrogates SLIT-ROBO signaling in vitro.

References
  • Brose K, et al. (1999) Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell. 96(6):795-806.
  • Brose K, et al. (1999) Slit2-Mediated chemorepulsion and collapse of developing forebrain axons. Neuron. 22(3):463-73.
  • Nagase T, et al. (2001) Prediction of the coding sequences of unidentified human genes. XVIII. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 7(4):273-81.
  • Size / Price
    Catalog: HG10310-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"