RNPS1 cDNA ORF Clone, Human, N-HA tag

Cat: HG14714-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNPS1 Reagents
CRO Services
Product recommended

All RNPS1 Reagents
RNPS1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Human RNA binding protein S1, serine-rich domain with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNPS1 cDNA ORF Clone, Human, N-HA tag Alternative Names
E5.1 cDNA ORF Clone, Human
RNPS1 Background Information
Full Name
RNA binding protein S1, serine-rich domain

RNPS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNPS1 cDNA ORF Clone in Cloning Vector, Rat RG8A0168-U
RNPS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0168-ACGLN

RNPS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNPS1 cDNA ORF Clone in Cloning Vector, Mouse MG5A2049-U
RNPS1 cDNA ORF Clone, Mouse, untagged MG5A2049-UT
RNPS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2049-ACGLN
RNPS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2049-ACG
RNPS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2049-ANG
RNPS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2049-ACR
RNPS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2049-ANR
RNPS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2049-CF
RNPS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2049-NF
RNPS1 cDNA ORF Clone, Mouse, C-His tag MG5A2049-CH
RNPS1 cDNA ORF Clone, Mouse, N-His tag MG5A2049-NH
RNPS1 cDNA ORF Clone, Mouse, C-HA tag MG5A2049-CY
RNPS1 cDNA ORF Clone, Mouse, N-HA tag MG5A2049-NY
RNPS1 cDNA ORF Clone, Mouse, C-Myc tag MG5A2049-CM
RNPS1 cDNA ORF Clone, Mouse, N-Myc tag MG5A2049-NM

RNPS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNPS1 cDNA ORF Clone in Cloning Vector, Human HG14714-G
RNPS1 cDNA ORF Clone, Human, untagged HG14714-UT
RNPS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14714-ACGLN
RNPS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14714-ACG
RNPS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14714-ANG
RNPS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14714-ACR
RNPS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14714-ANR
RNPS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14714-CF
RNPS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14714-NF
RNPS1 cDNA ORF Clone, Human, C-His tag HG14714-CH
RNPS1 cDNA ORF Clone, Human, N-His tag HG14714-NH
RNPS1 cDNA ORF Clone, Human, C-HA tag HG14714-CY
RNPS1 cDNA ORF Clone, Human, C-Myc tag HG14714-CM
RNPS1 cDNA ORF Clone, Human, N-Myc tag HG14714-NM
RNPS1 qPCR Primer Pairs, Human HP103348
info info
添加购物车成功! 添加购物车失败!