RNF7 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16223-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNF7 Reagents
CRO Services
Product recommended

All RNF7 Reagents
RNF7 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
342 bp
Description
Full length Clone DNA of Human ring finger protein 7 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNF7 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CKBBP1 cDNA ORF Clone, Human;ROC2 cDNA ORF Clone, Human;SAG cDNA ORF Clone, Human
RNF7 Background Information
Full Name
ring finger protein 7

RNF7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNF7 cDNA ORF Clone in Cloning Vector, Mouse MG5A0575-U
RNF7 cDNA ORF Clone, Mouse, untagged MG5A0575-UT
RNF7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0575-ACGLN
RNF7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0575-ACG
RNF7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0575-ANG
RNF7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0575-ACR
RNF7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0575-ANR
RNF7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0575-CF
RNF7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0575-NF
RNF7 cDNA ORF Clone, Mouse, C-His tag MG5A0575-CH
RNF7 cDNA ORF Clone, Mouse, N-His tag MG5A0575-NH
RNF7 cDNA ORF Clone, Mouse, C-HA tag MG5A0575-CY
RNF7 cDNA ORF Clone, Mouse, N-HA tag MG5A0575-NY
RNF7 cDNA ORF Clone, Mouse, C-Myc tag MG5A0575-CM
RNF7 cDNA ORF Clone, Mouse, N-Myc tag MG5A0575-NM

RNF7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNF7 cDNA ORF Clone in Cloning Vector, Human HG16223-G
RNF7 cDNA ORF Clone, Human, untagged HG16223-UT
RNF7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16223-ACGLN
RNF7 cDNA ORF Clone, Human, C-GFPSpark® tag HG16223-ACG
RNF7 cDNA ORF Clone, Human, N-GFPSpark® tag HG16223-ANG
RNF7 cDNA ORF Clone, Human, C-OFPSpark® tag HG16223-ACR
RNF7 cDNA ORF Clone, Human, N-OFPSpark® tag HG16223-ANR
RNF7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16223-CF
RNF7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16223-NF
RNF7 cDNA ORF Clone, Human, C-His tag HG16223-CH
RNF7 cDNA ORF Clone, Human, N-His tag HG16223-NH
RNF7 cDNA ORF Clone, Human, C-HA tag HG16223-CY
RNF7 cDNA ORF Clone, Human, N-HA tag HG16223-NY
RNF7 cDNA ORF Clone, Human, C-Myc tag HG16223-CM
RNF7 qPCR Primer Pairs, Human HP104988
info info
添加购物车成功! 添加购物车失败!