RNF114 cDNA ORF Clone, Human, N-Myc tag

Cat: HG16235-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNF114 Reagents
CRO Services
Product recommended

All RNF114 Reagents
RNF114 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human ring finger protein 114 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNF114 cDNA ORF Clone, Human, N-Myc tag Alternative Names
PSORS12 cDNA ORF Clone, Human;ZNF313 cDNA ORF Clone, Human
RNF114 Background Information
Full Name
ring finger protein 114

RNF114 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
RNF114 cDNA ORF Clone in Cloning Vector, Canine DG70238-U
RNF114 cDNA ORF Clone, Canine, untagged DG70238-UT
RNF114 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70238-ACGLN
RNF114 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70238-ACG
RNF114 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70238-ANG
RNF114 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70238-ACR
RNF114 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70238-ANR
RNF114 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70238-CF
RNF114 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70238-NF
RNF114 cDNA ORF Clone, Canine, C-His tag DG70238-CH
RNF114 cDNA ORF Clone, Canine, N-His tag DG70238-NH
RNF114 cDNA ORF Clone, Canine, C-HA tag DG70238-CY
RNF114 cDNA ORF Clone, Canine, N-HA tag DG70238-NY
RNF114 cDNA ORF Clone, Canine, C-Myc tag DG70238-CM
RNF114 cDNA ORF Clone, Canine, N-Myc tag DG70238-NM

RNF114 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNF114 cDNA ORF Clone in Cloning Vector, Rat RG80838-U
RNF114 cDNA ORF Clone, Rat, untagged RG80838-UT
RNF114 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80838-ACGLN
RNF114 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80838-ACG
RNF114 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80838-ANG
RNF114 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80838-ACR
RNF114 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80838-ANR
RNF114 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80838-CF
RNF114 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80838-NF
RNF114 cDNA ORF Clone, Rat, C-His tag RG80838-CH
RNF114 cDNA ORF Clone, Rat, N-His tag RG80838-NH
RNF114 cDNA ORF Clone, Rat, C-HA tag RG80838-CY
RNF114 cDNA ORF Clone, Rat, N-HA tag RG80838-NY
RNF114 cDNA ORF Clone, Rat, C-Myc tag RG80838-CM
RNF114 cDNA ORF Clone, Rat, N-Myc tag RG80838-NM
RNF114 qPCR Primer Pairs, Rat RP300802

RNF114 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNF114 cDNA ORF Clone in Cloning Vector, Mouse MG53035-G
RNF114 cDNA ORF Clone, Mouse, untagged MG53035-UT
RNF114 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53035-ACGLN
RNF114 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53035-ACG
RNF114 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53035-ANG
RNF114 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53035-ACR
RNF114 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53035-ANR
RNF114 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53035-CF
RNF114 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53035-NF
RNF114 cDNA ORF Clone, Mouse, C-His tag MG53035-CH
RNF114 cDNA ORF Clone, Mouse, N-His tag MG53035-NH
RNF114 cDNA ORF Clone, Mouse, C-HA tag MG53035-CY
RNF114 cDNA ORF Clone, Mouse, N-HA tag MG53035-NY
RNF114 cDNA ORF Clone, Mouse, C-Myc tag MG53035-CM
RNF114 cDNA ORF Clone, Mouse, N-Myc tag MG53035-NM

RNF114 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNF114 cDNA ORF Clone in Cloning Vector, Human HG16235-G
RNF114 cDNA ORF Clone, Human, untagged HG16235-UT
RNF114 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16235-ACGLN
RNF114 cDNA ORF Clone, Human, C-GFPSpark® tag HG16235-ACG
RNF114 cDNA ORF Clone, Human, N-GFPSpark® tag HG16235-ANG
RNF114 cDNA ORF Clone, Human, C-OFPSpark® tag HG16235-ACR
RNF114 cDNA ORF Clone, Human, N-OFPSpark® tag HG16235-ANR
RNF114 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16235-CF
RNF114 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16235-NF
RNF114 cDNA ORF Clone, Human, C-His tag HG16235-CH
RNF114 cDNA ORF Clone, Human, N-His tag HG16235-NH
RNF114 cDNA ORF Clone, Human, C-HA tag HG16235-CY
RNF114 cDNA ORF Clone, Human, N-HA tag HG16235-NY
RNF114 cDNA ORF Clone, Human, C-Myc tag HG16235-CM
RNF114 qPCR Primer Pairs, Human HP104999
info info
添加购物车成功! 添加购物车失败!