After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human RNASET2 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human RNASET2 cDNA Clone Product Information
NCBI RefSeq:BC001660
RefSeq ORF Size:771bp
cDNA Description:Full length Clone DNA of Homo sapiens ribonuclease T2 with C terminal HA tag.
Gene Synonym:RNASE6PL, bA514O12.3, RP11-514O12.3, RNASET2
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

RNASET2 (ribonuclease T2) is an enzyme which belongs to the RNase T2 family. It is highly expressed in the temporal lobe and fetal brain. RNASET2 gene is a novel member of the Rh/T2/S-glycoprotein class of extracellular ribonucleases. It is a single copy gene that maps to 6q27, a region associated with human malignancies and chromosomal rearrangement. Defects in RNASET2 are the cause of leukoencephalopathy cystic without megalencephaly. An infantile-onset syndrome of cerebral leukoencephalopathy. Affected newborns develop microcephaly and neurologic abnormalities including psychomotor impairment, seizures and sensorineural hearing impairment. The brain shows multifocal white matter lesions, anterior temporal lobe subcortical cysts, pericystic abnormal myelination, ventriculomegaly and intracranial calcifications.

References
  • Acquati F, et al. (2011) A Molecular signature induced by RNASET2, a tumor antagonizing gene, in ovarian cancer cells. Oncotarget. 2(6):477-84.
  • Campomenosi P, et al. (2011) Comparison of the baculovirus-insect cell and Pichia pastoris heterologous systems for the expression of the human tumor suppressor protein RNASET2. Biotechnol Appl Biochem. 58(1):39-49.
  • Monti L, et al. (2008) RNASET2 as a tumor antagonizing gene in a melanoma cancer model. Oncol Res. 17(2):69-74.
  • Size / Price
    Catalog: HG13509-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"