RNASEL/RNS4 cDNA ORF Clone, Human, N-His tag

Cat: HG10858-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RNASEL/RNS4 Reagents
CRO Services
Product recommended

All RNASEL/RNS4 Reagents
RNASEL/RNS4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2271 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
HindIII + NotI(6kb+2.27kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RNASEL/RNS4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNASEL/RNS4 cDNA ORF Clone, Human, N-His tag Validated Images
Human DHCR7 Gene Plasmid Map 5861
RNASEL/RNS4 cDNA ORF Clone, Human, N-His tag Alternative Names
PRCA1 cDNA ORF Clone, Human;RNS4 cDNA ORF Clone, Human
RNASEL/RNS4 Background Information
Full Name
ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)

RNASEL/RNS4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNASEL/RNS4 cDNA ORF Clone in Cloning Vector, Mouse MG51054-G
RNASEL/RNS4 cDNA ORF Clone, Mouse, untagged MG51054-UT
RNASEL/RNS4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51054-ACGLN
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51054-ACG
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51054-ANG
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51054-ACR
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51054-ANR
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51054-CF
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51054-NF
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-His tag MG51054-CH
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-His tag MG51054-NH
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-HA tag MG51054-CY
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-HA tag MG51054-NY
RNASEL/RNS4 cDNA ORF Clone, Mouse, C-Myc tag MG51054-CM
RNASEL/RNS4 cDNA ORF Clone, Mouse, N-Myc tag MG51054-NM
RNASEL/RNS4 qPCR Primer Pairs, Mouse MP201012

RNASEL/RNS4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNASEL/RNS4 cDNA ORF Clone in Cloning Vector, Human HG10858-M
RNASEL/RNS4 cDNA ORF Clone, Human, untagged HG10858-UT
RNASEL/RNS4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10858-ACG
RNASEL/RNS4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10858-ACGLN
RNASEL/RNS4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10858-ANG
RNASEL/RNS4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10858-ACR
RNASEL/RNS4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10858-ANR
RNASEL/RNS4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10858-CF
RNASEL/RNS4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10858-NF
RNASEL/RNS4 cDNA ORF Clone, Human, C-His tag HG10858-CH
RNASEL/RNS4 cDNA ORF Clone, Human, C-HA tag HG10858-CY
RNASEL/RNS4 cDNA ORF Clone, Human, N-HA tag HG10858-NY
RNASEL/RNS4 cDNA ORF Clone, Human, C-Myc tag HG10858-CM
RNASEL/RNS4 cDNA ORF Clone, Human, N-Myc tag HG10858-NM
RNASEL/RNS4 qPCR Primer Pairs, Human HP100925
info info
添加购物车成功! 添加购物车失败!