RNASEH2A cDNA ORF Clone, Human, N-Myc tag

Cat: HG15528-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RNASEH2A Reagents
CRO Services
Product recommended

All RNASEH2A Reagents
RNASEH2A cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
900 bp
Description
Full length Clone DNA of Human ribonuclease H2, subunit A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RNASEH2A cDNA ORF Clone, Human, N-Myc tag Alternative Names
AGS4 cDNA ORF Clone, Human;JUNB cDNA ORF Clone, Human;RNASEHI cDNA ORF Clone, Human;RNHIA cDNA ORF Clone, Human;RNHL cDNA ORF Clone, Human
RNASEH2A Background Information
Full Name
ribonuclease H2, subunit A

RNASEH2A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RNASEH2A cDNA ORF Clone in Cloning Vector, Rat RG89816-U
RNASEH2A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89816-ACGLN

RNASEH2A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RNASEH2A cDNA ORF Clone in Cloning Vector, Mouse MG5A3903-U
RNASEH2A cDNA ORF Clone, Mouse, untagged MG5A3903-UT
RNASEH2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3903-ACG
RNASEH2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3903-ACGLN
RNASEH2A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3903-ANG
RNASEH2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3903-ACR
RNASEH2A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3903-ANR
RNASEH2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3903-CF
RNASEH2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3903-NF
RNASEH2A cDNA ORF Clone, Mouse, C-His tag MG5A3903-CH
RNASEH2A cDNA ORF Clone, Mouse, N-His tag MG5A3903-NH
RNASEH2A cDNA ORF Clone, Mouse, C-HA tag MG5A3903-CY
RNASEH2A cDNA ORF Clone, Mouse, N-HA tag MG5A3903-NY
RNASEH2A cDNA ORF Clone, Mouse, C-Myc tag MG5A3903-CM
RNASEH2A cDNA ORF Clone, Mouse, N-Myc tag MG5A3903-NM

RNASEH2A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RNASEH2A cDNA ORF Clone in Cloning Vector, Human HG15528-G
RNASEH2A cDNA ORF Clone, Human, untagged HG15528-UT
RNASEH2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15528-ACGLN
RNASEH2A cDNA ORF Clone, Human, C-GFPSpark® tag HG15528-ACG
RNASEH2A cDNA ORF Clone, Human, N-GFPSpark® tag HG15528-ANG
RNASEH2A cDNA ORF Clone, Human, C-OFPSpark® tag HG15528-ACR
RNASEH2A cDNA ORF Clone, Human, N-OFPSpark® tag HG15528-ANR
RNASEH2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15528-CF
RNASEH2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15528-NF
RNASEH2A cDNA ORF Clone, Human, C-His tag HG15528-CH
RNASEH2A cDNA ORF Clone, Human, N-His tag HG15528-NH
RNASEH2A cDNA ORF Clone, Human, C-HA tag HG15528-CY
RNASEH2A cDNA ORF Clone, Human, N-HA tag HG15528-NY
RNASEH2A cDNA ORF Clone, Human, C-Myc tag HG15528-CM
RNASEH2A qPCR Primer Pairs, Human HP104149
info info
添加购物车成功! 添加购物车失败!