Ribonuclease A cDNA ORF Clone, Human, C-His tag

Cat: HG13468-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ribonuclease A Reagents
CRO Services
Product recommended

All Ribonuclease A Reagents
Ribonuclease A cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
471 bp
Description
Full length Clone DNA of Human ribonuclease, RNase A family, 1 (pancreatic) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ribonuclease A cDNA ORF Clone, Human, C-His tag Alternative Names
RAC1 cDNA ORF Clone, Human;RIB1 cDNA ORF Clone, Human;RNS1 cDNA ORF Clone, Human
Ribonuclease A Background Information

RNase A, also known as ribonuclease A and RNASE1, belongs to ribonuclease A superfamily. It is a pancreatic-type of secretory ribonuclease. RNase A is a basic protein and its many positive charges are consistent with its binding to RNA (a poly-anion). More generally, RNase A is unusually polar or, rather, unusually lacking in hydrophobic groups, especially aliphatic ones. As a endonuclease, RNase A cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. RNase A is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified.

Full Name
ribonuclease, RNase A family, 1 (pancreatic)
References
  • Tubert P, et al. (2011) Interactions crucial for three-dimensional domain swapping in the HP-RNase variant PM8. Biophys J. 101(2):459-67.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Fischer S, et al. (2011) Expression and localisation of vascular ribonucleases in endothelial cells. Thromb Haemost. 105(2):345-55.
  • Ribonuclease A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ribonuclease A cDNA ORF Clone in Cloning Vector, Mouse MG53784-U
    Ribonuclease A cDNA ORF Clone, Mouse, untagged MG53784-UT
    Ribonuclease A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53784-ACGLN
    Ribonuclease A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53784-ACG
    Ribonuclease A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53784-ACR
    Ribonuclease A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53784-CF
    Ribonuclease A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53784-NF
    Ribonuclease A cDNA ORF Clone, Mouse, C-His tag MG53784-CH
    Ribonuclease A cDNA ORF Clone, Mouse, N-His tag MG53784-NH
    Ribonuclease A cDNA ORF Clone, Mouse, C-HA tag MG53784-CY
    Ribonuclease A cDNA ORF Clone, Mouse, N-HA tag MG53784-NY
    Ribonuclease A cDNA ORF Clone, Mouse, C-Myc tag MG53784-CM
    Ribonuclease A cDNA ORF Clone, Mouse, N-Myc tag MG53784-NM

    Ribonuclease A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ribonuclease A cDNA ORF Clone in Cloning Vector, Human HG13468-G
    Ribonuclease A cDNA ORF Clone, Human, untagged HG13468-UT
    Ribonuclease A cDNA ORF Clone, Human, C-GFPSpark® tag HG13468-ACG
    Ribonuclease A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13468-ACGLN
    Ribonuclease A cDNA ORF Clone, Human, C-OFPSpark® tag HG13468-ACR
    Ribonuclease A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13468-CF
    Ribonuclease A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13468-NF
    Ribonuclease A cDNA ORF Clone, Human, N-His tag HG13468-NH
    Ribonuclease A cDNA ORF Clone, Human, C-HA tag HG13468-CY
    Ribonuclease A cDNA ORF Clone, Human, N-HA tag HG13468-NY
    Ribonuclease A cDNA ORF Clone, Human, C-Myc tag HG13468-CM
    Ribonuclease A cDNA ORF Clone, Human, N-Myc tag HG13468-NM
    Ribonuclease A qPCR Primer Pairs, Human HP102168
    info info
    添加购物车成功! 添加购物车失败!