Quick Order

Text Size:AAA

Human RNase A / Ribonuclease A / RNASE1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human RNASE1 cDNA Clone Product Information
NCBI RefSeq:BC005324
RefSeq ORF Size:471bp
cDNA Description:Full length Clone DNA of Homo sapiens ribonuclease, RNase A family, 1 (pancreatic) with C terminal His tag.
Gene Synonym:RIB1, RNS1, RNASE1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

RNase A, also known as ribonuclease A and RNASE1, belongs to ribonuclease A superfamily. It is a pancreatic-type of secretory ribonuclease. RNase A is a basic protein and its many positive charges are consistent with its binding to RNA (a poly-anion). More generally, RNase A is unusually polar or, rather, unusually lacking in hydrophobic groups, especially aliphatic ones. As a endonuclease, RNase A cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. RNase A is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified.

References
  • Tubert P, et al. (2011) Interactions crucial for three-dimensional domain swapping in the HP-RNase variant PM8. Biophys J. 101(2):459-67.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Fischer S, et al. (2011) Expression and localisation of vascular ribonucleases in endothelial cells. Thromb Haemost. 105(2):345-55.
  • Size / Price
    Catalog: HG13468-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"