FAM82B cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13485-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All FAM82B Reagents
CRO Services
Product recommended

All FAM82B Reagents
FAM82B cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Human family with sequence similarity 82, member B with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
More Information About FAM82B
Entrez Gene ID

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FAM82B cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CGI-90 cDNA ORF Clone, Human;FAM82B cDNA ORF Clone, Human;RMD-1 cDNA ORF Clone, Human;RMD1 cDNA ORF Clone, Human
FAM82B Background Information
Full Name
regulator of microtubule dynamics 1

FAM82B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FAM82B cDNA ORF Clone in Cloning Vector, Mouse MG53349-U
FAM82B cDNA ORF Clone, Mouse, untagged MG53349-UT
FAM82B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53349-ACGLN
FAM82B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53349-ACG
FAM82B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53349-ANG
FAM82B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53349-ACR
FAM82B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53349-ANR
FAM82B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53349-CF
FAM82B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53349-NF
FAM82B cDNA ORF Clone, Mouse, C-His tag MG53349-CH
FAM82B cDNA ORF Clone, Mouse, N-His tag MG53349-NH
FAM82B cDNA ORF Clone, Mouse, C-HA tag MG53349-CY
FAM82B cDNA ORF Clone, Mouse, N-HA tag MG53349-NY
FAM82B cDNA ORF Clone, Mouse, C-Myc tag MG53349-CM
FAM82B cDNA ORF Clone, Mouse, N-Myc tag MG53349-NM

FAM82B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FAM82B cDNA ORF Clone in Cloning Vector, Human HG13485-G
FAM82B cDNA ORF Clone, Human, untagged HG13485-UT
FAM82B cDNA ORF Clone, Human, C-GFPSpark® tag HG13485-ACG
FAM82B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13485-ACGLN
FAM82B cDNA ORF Clone, Human, N-GFPSpark® tag HG13485-ANG
FAM82B cDNA ORF Clone, Human, C-OFPSpark® tag HG13485-ACR
FAM82B cDNA ORF Clone, Human, N-OFPSpark® tag HG13485-ANR
FAM82B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13485-CF
FAM82B cDNA ORF Clone, Human, C-His tag HG13485-CH
FAM82B cDNA ORF Clone, Human, N-His tag HG13485-NH
FAM82B cDNA ORF Clone, Human, C-HA tag HG13485-CY
FAM82B cDNA ORF Clone, Human, N-HA tag HG13485-NY
FAM82B cDNA ORF Clone, Human, C-Myc tag HG13485-CM
FAM82B cDNA ORF Clone, Human, N-Myc tag HG13485-NM
FAM82B qPCR Primer Pairs, Human HP102185
info info
添加购物车成功! 添加购物车失败!