Text Size:AAA

Human Relaxin-2/RLN2 transcript variant 1 Gene ORF cDNA clone expression plasmid

  • Human RLN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human RLN2 cDNA Clone Product Information
NCBI RefSeq:NM_134441.1
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Homo sapiens relaxin 2, transcript variant 1.
Gene Synonym:H2, RLXH2, bA12D24.1.1, bA12D24.1.2, RLN2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RLN2
Restriction Site:KpnI + XbaI (6.1kb + 0.56kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RLN2 qPCR primers for gene expression analysis, HP101477 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RLN2 Gene Plasmid Map
Human RLN2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11624-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"