Text Size:AAA

Human Relaxin-1 / RLN1 Gene ORF cDNA clone expression plasmid

  • Human RLN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human RLN1 cDNA Clone Product Information
NCBI RefSeq:NM_006911.2
RefSeq ORF Size:558bp
cDNA Description:Full length Clone DNA of Homo sapiens relaxin 1.
Gene Synonym:H1, RLXH1, bA12D24.3.1, bA12D24.3.2, RLN1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RLN1
Restriction Site:KpnI + XbaI (6.1kb + 0.56kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 399G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RLN1 qPCR primers for gene expression analysis, HP101478 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RLN1 Gene Plasmid Map
Human RLN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Relaxin-1, also known as Prorelaxin H1 and RLN1, is a secreted protein which belongs to the insulin family. It is a peptide hormone that was first described in 1926 by Frederick Hisaw. Since its discovery as a reproductive hormone 80 years ago, relaxin has been implicated in a number of pregnancy-related functions involving extracellular matrix (ECM) turnover and collagen degradation. It is now becoming evident that relaxin's ability to reduce matrix synthesis and increase ECM degradation has important implications in several nonreproductive organs, including the heart, lung, kidney, liver and skin. The relaxin-like peptide family belongs in the insulin superfamily and consists of 7 peptides of high structural but low sequence similarity; relaxin-1 (RNL1), relaxin-2 (RNL2) and relaxin-3 ( RNL3), and the insulin-like (INSL) peptides, INSL3, INSL4, INSL5 and INSL6. The functions of relaxin-3, INSL4, INSL5, INSL6 remain uncharacterised. Relaxin-1 / RLN1 is an ovarian hormone that acts with estrogen to produce dilatation of the birth canal in many mammals. Relaxin-1 / RLN1 may be involved in remodeling of connective tissues during pregnancy, promoting growth of pubic ligaments and ripening of the cervix. Relaxin and estrogen appear to play protective roles against airway fibrosis, airway SM thickening, and cardiac hypertrophy. Relaxin may also provide a means to regulate excessive collagen deposition during kidney development and in diseased states characterized by renal fibrosis.

References
  • Bathgate,R.A. et al., 2003, ends Endocrinol Metab  14 (5):207-13.
  • Samuel,C.S. et al., 2003, Curr Opin Pharmacol. 3 (2):152-8.
  • Samuel,C.S. et al., 2004,Kidney Int. 65 (6):2054-64.
  • Lekgabe,E.D. et al., 2006, Endocrinology. 147 (12):5575-83.
  • Samuel,C.S. et al., 2007, Adv Exp Med Biol  612: 88-103.
  • Size / Price
    Catalog: HG11625-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"