Text Size:AAA

Human Relaxin-1 / RLN1 Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human RLN1 cDNA Clone Product Information
    NCBI RefSeq:NM_006911.2
    RefSeq ORF Size:558bp
    cDNA Description:Full length Clone DNA of Homo sapiens relaxin 1 with N terminal Flag tag.
    Gene Synonym:H1, RLXH1, bA12D24.3.1, bA12D24.3.2, RLN1
    Species:Human
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RLN1 qPCR primers for gene expression analysis, HP101478 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Relaxin-1, also known as Prorelaxin H1 and RLN1, is a secreted protein which belongs to the insulin family. It is a peptide hormone that was first described in 1926 by Frederick Hisaw. Since its discovery as a reproductive hormone 80 years ago, relaxin has been implicated in a number of pregnancy-related functions involving extracellular matrix (ECM) turnover and collagen degradation. It is now becoming evident that relaxin's ability to reduce matrix synthesis and increase ECM degradation has important implications in several nonreproductive organs, including the heart, lung, kidney, liver and skin. The relaxin-like peptide family belongs in the insulin superfamily and consists of 7 peptides of high structural but low sequence similarity; relaxin-1 (RNL1), relaxin-2 (RNL2) and relaxin-3 ( RNL3), and the insulin-like (INSL) peptides, INSL3, INSL4, INSL5 and INSL6. The functions of relaxin-3, INSL4, INSL5, INSL6 remain uncharacterised. Relaxin-1 / RLN1 is an ovarian hormone that acts with estrogen to produce dilatation of the birth canal in many mammals. Relaxin-1 / RLN1 may be involved in remodeling of connective tissues during pregnancy, promoting growth of pubic ligaments and ripening of the cervix. Relaxin and estrogen appear to play protective roles against airway fibrosis, airway SM thickening, and cardiac hypertrophy. Relaxin may also provide a means to regulate excessive collagen deposition during kidney development and in diseased states characterized by renal fibrosis.

    References
  • Bathgate,R.A. et al., 2003, ends Endocrinol Metab  14 (5):207-13.
  • Samuel,C.S. et al., 2003, Curr Opin Pharmacol. 3 (2):152-8.
  • Samuel,C.S. et al., 2004,Kidney Int. 65 (6):2054-64.
  • Lekgabe,E.D. et al., 2006, Endocrinology. 147 (12):5575-83.
  • Samuel,C.S. et al., 2007, Adv Exp Med Biol  612: 88-103.
  • Size / Price
    Catalog: HG11625-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"