RITA1 cDNA ORF Clone, Human, C-His tag

Cat: HG16420-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RITA1 Reagents
CRO Services
Product recommended

All RITA1 Reagents
RITA1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
810 bp
Description
Full length Clone DNA of Human RBPJ interacting and tubulin associated 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RITA1 cDNA ORF Clone, Human, C-His tag Alternative Names
C12orf52 cDNA ORF Clone, Human;RITA cDNA ORF Clone, Human
RITA1 Background Information
Full Name
RBPJ interacting and tubulin associated 1

RITA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RITA1 cDNA ORF Clone in Cloning Vector, Mouse MG52904-G
RITA1 cDNA ORF Clone, Mouse, untagged MG52904-UT
RITA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52904-ACGLN
RITA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52904-ACG
RITA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52904-ACR
RITA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52904-CF
RITA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52904-NF
RITA1 cDNA ORF Clone, Mouse, C-His tag MG52904-CH
RITA1 cDNA ORF Clone, Mouse, N-His tag MG52904-NH
RITA1 cDNA ORF Clone, Mouse, C-HA tag MG52904-CY
RITA1 cDNA ORF Clone, Mouse, N-HA tag MG52904-NY
RITA1 cDNA ORF Clone, Mouse, C-Myc tag MG52904-CM
RITA1 cDNA ORF Clone, Mouse, N-Myc tag MG52904-NM

RITA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RITA1 cDNA ORF Clone in Cloning Vector, Human HG16420-G
RITA1 cDNA ORF Clone, Human, untagged HG16420-UT
RITA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16420-ACG
RITA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16420-ACGLN
RITA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16420-ANG
RITA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16420-ACR
RITA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16420-ANR
RITA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16420-CF
RITA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16420-NF
RITA1 cDNA ORF Clone, Human, N-His tag HG16420-NH
RITA1 cDNA ORF Clone, Human, C-HA tag HG16420-CY
RITA1 cDNA ORF Clone, Human, N-HA tag HG16420-NY
RITA1 cDNA ORF Clone, Human, C-Myc tag HG16420-CM
RITA1 cDNA ORF Clone, Human, N-Myc tag HG16420-NM
RITA1 qPCR Primer Pairs, Human HP105169
info info
添加购物车成功! 添加购物车失败!