RIOK2 cDNA ORF Clone, Human, N-His tag

Cat: HG16164-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RIOK2 Reagents
CRO Services
Product recommended

All RIOK2 Reagents
RIOK2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1659 bp
Description
Full length Clone DNA of Human RIO kinase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RIOK2 cDNA ORF Clone, Human, N-His tag Alternative Names
RIO2 cDNA ORF Clone, Human
RIOK2 Background Information
Full Name
RIO kinase 2

RIOK2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RIOK2 cDNA ORF Clone in Cloning Vector, Mouse MG5A4224-U
RIOK2 cDNA ORF Clone, Mouse, untagged MG5A4224-UT
RIOK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4224-ACGLN
RIOK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4224-ACG
RIOK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4224-ANG
RIOK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4224-ACR
RIOK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4224-ANR
RIOK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4224-CF
RIOK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4224-NF
RIOK2 cDNA ORF Clone, Mouse, C-His tag MG5A4224-CH
RIOK2 cDNA ORF Clone, Mouse, N-His tag MG5A4224-NH
RIOK2 cDNA ORF Clone, Mouse, C-HA tag MG5A4224-CY
RIOK2 cDNA ORF Clone, Mouse, N-HA tag MG5A4224-NY
RIOK2 cDNA ORF Clone, Mouse, C-Myc tag MG5A4224-CM
RIOK2 cDNA ORF Clone, Mouse, N-Myc tag MG5A4224-NM

RIOK2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RIOK2 cDNA ORF Clone in Cloning Vector, Human HG16164-G
RIOK2 cDNA ORF Clone, Human, untagged HG16164-UT
RIOK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16164-ACG
RIOK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16164-ACGLN
RIOK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16164-ANG
RIOK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16164-ACR
RIOK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16164-ANR
RIOK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16164-CF
RIOK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16164-NF
RIOK2 cDNA ORF Clone, Human, C-His tag HG16164-CH
RIOK2 cDNA ORF Clone, Human, C-HA tag HG16164-CY
RIOK2 cDNA ORF Clone, Human, N-HA tag HG16164-NY
RIOK2 cDNA ORF Clone, Human, C-Myc tag HG16164-CM
RIOK2 cDNA ORF Clone, Human, N-Myc tag HG16164-NM
RIOK2 qPCR Primer Pairs, Human HP104933
info info
添加购物车成功! 添加购物车失败!