Quick Order

Text Size:AAA

Human RIOK1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human RIOK1 cDNA Clone Product Information
NCBI RefSeq:BC006104
RefSeq ORF Size:1707bp
cDNA Description:Full length Clone DNA of Homo sapiens RIO kinase 1.
Gene Synonym:AD034, RRP10, bA288G3.1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

RIOK1, also known as RIO kinase 1, is a member of the RIO family of atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its symmetrical methylation.

References
  • Widmann B. et al., 2012, Mol Biol Cell. 23 (1): 22-35.
  • LaRonde-LeBlanc N. et al., 2005, Biochim Biophys Acta. 1754 (1-2): 14-24.
  • Guderian G. et al., 2011, J Biol Chem. 286 (3): 1976-86.
  • Size / Price
    Catalog: HG14477-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"