Quick Order

Text Size:AAA

Human RIOK1 / RIO kinase 1 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human RIOK1 cDNA Clone Product Information
    NCBI RefSeq:BC006104
    RefSeq ORF Size:1707bp
    cDNA Description:Full length Clone DNA of Homo sapiens RIO kinase 1.
    Gene Synonym:AD034, RRP10, bA288G3.1
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RIOK1 qPCR primers for gene expression analysis, HP103125 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    RIOK1, also known as RIO kinase 1, is a member of the RIO family of atypical serine protein kinases first characterized in yeast. RIOK1 and RIOK2 proteins are present in organisms from Archaea to humans. RIOK1 functios as a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex composition and substrate specificity. RioK1 and pICln bind to PRMT5 in a mutually exclusive fashion. This results in a PRMT5-WD45/MEP50 core structure that either associates with pICln or RioK1 RIOK1 in distinct complexes. RIOK1 functions in analogy to pICln as an adapter protein by recruiting the RNA-binding protein nucleolin to the PRMT5 complex for its symmetrical methylation.

    References
  • Widmann B. et al., 2012, Mol Biol Cell. 23 (1): 22-35.
  • LaRonde-LeBlanc N. et al., 2005, Biochim Biophys Acta. 1754 (1-2): 14-24.
  • Guderian G. et al., 2011, J Biol Chem. 286 (3): 1976-86.
  • Size / Price
    Catalog: HG14477-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"