RHOQ cDNA ORF Clone, Human, N-Myc tag

Cat: HG15574-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RHOQ Reagents
CRO Services
Product recommended

All RHOQ Reagents
RHOQ cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Human ras homolog family member Q with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RHOQ cDNA ORF Clone, Human, N-Myc tag Alternative Names
ARHQ cDNA ORF Clone, Human;HEL-S-42 cDNA ORF Clone, Human;RASL7A cDNA ORF Clone, Human;TC10 cDNA ORF Clone, Human;TC10A cDNA ORF Clone, Human
RHOQ Background Information
Full Name
ras homolog family member Q

RHOQ cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RHOQ cDNA ORF Clone in Cloning Vector, Mouse MG5A0447-U
RHOQ cDNA ORF Clone, Mouse, untagged MG5A0447-UT
RHOQ Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0447-ACGLN
RHOQ cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0447-ACG
RHOQ cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0447-ANG
RHOQ cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0447-ACR
RHOQ cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0447-ANR
RHOQ cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0447-CF
RHOQ cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0447-NF
RHOQ cDNA ORF Clone, Mouse, C-His tag MG5A0447-CH
RHOQ cDNA ORF Clone, Mouse, N-His tag MG5A0447-NH
RHOQ cDNA ORF Clone, Mouse, C-HA tag MG5A0447-CY
RHOQ cDNA ORF Clone, Mouse, N-HA tag MG5A0447-NY
RHOQ cDNA ORF Clone, Mouse, C-Myc tag MG5A0447-CM
RHOQ cDNA ORF Clone, Mouse, N-Myc tag MG5A0447-NM

RHOQ cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RHOQ cDNA ORF Clone in Cloning Vector, Human HG15574-G
RHOQ cDNA ORF Clone, Human, untagged HG15574-UT
RHOQ Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15574-ACGLN
RHOQ cDNA ORF Clone, Human, C-GFPSpark® tag HG15574-ACG
RHOQ cDNA ORF Clone, Human, N-GFPSpark® tag HG15574-ANG
RHOQ cDNA ORF Clone, Human, C-OFPSpark® tag HG15574-ACR
RHOQ cDNA ORF Clone, Human, N-OFPSpark® tag HG15574-ANR
RHOQ cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15574-CF
RHOQ cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15574-NF
RHOQ cDNA ORF Clone, Human, C-His tag HG15574-CH
RHOQ cDNA ORF Clone, Human, N-His tag HG15574-NH
RHOQ cDNA ORF Clone, Human, C-HA tag HG15574-CY
RHOQ cDNA ORF Clone, Human, N-HA tag HG15574-NY
RHOQ cDNA ORF Clone, Human, C-Myc tag HG15574-CM
RHOQ qPCR Primer Pairs, Human HP104194
info info
添加购物车成功! 添加购物车失败!