RHOJ cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15216-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RHOJ Reagents
CRO Services
Product recommended

All RHOJ Reagents
RHOJ cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
645 bp
Description
Full length Clone DNA of Human ras homolog family member J with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RHOJ cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
ARHJ cDNA ORF Clone, Human;RASL7B cDNA ORF Clone, Human;TC10B cDNA ORF Clone, Human;TCL cDNA ORF Clone, Human
RHOJ Background Information
Full Name
ras homolog family member J

RHOJ cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RHOJ cDNA ORF Clone in Cloning Vector, Rat RG87908-U
RHOJ Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87908-ACGLN

RHOJ cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RHOJ cDNA ORF Clone in Cloning Vector, Mouse MG52145-U
RHOJ cDNA ORF Clone, Mouse, untagged MG52145-UT
RHOJ Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52145-ACGLN
RHOJ cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52145-ACG
RHOJ cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52145-ANG
RHOJ cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52145-ACR
RHOJ cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52145-ANR
RHOJ cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52145-CF
RHOJ cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52145-NF
RHOJ cDNA ORF Clone, Mouse, C-His tag MG52145-CH
RHOJ cDNA ORF Clone, Mouse, N-His tag MG52145-NH
RHOJ cDNA ORF Clone, Mouse, C-HA tag MG52145-CY
RHOJ cDNA ORF Clone, Mouse, N-HA tag MG52145-NY
RHOJ cDNA ORF Clone, Mouse, C-Myc tag MG52145-CM
RHOJ cDNA ORF Clone, Mouse, N-Myc tag MG52145-NM
RHOJ qPCR Primer Pairs, Mouse MP202018

RHOJ cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RHOJ cDNA ORF Clone in Cloning Vector, Human HG15216-G
RHOJ cDNA ORF Clone, Human, untagged HG15216-UT
RHOJ Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15216-ACGLN
RHOJ cDNA ORF Clone, Human, C-GFPSpark® tag HG15216-ACG
RHOJ cDNA ORF Clone, Human, C-OFPSpark® tag HG15216-ACR
RHOJ cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15216-NF
RHOJ cDNA ORF Clone, Human, C-His tag HG15216-CH
RHOJ cDNA ORF Clone, Human, N-His tag HG15216-NH
RHOJ cDNA ORF Clone, Human, C-HA tag HG15216-CY
RHOJ cDNA ORF Clone, Human, N-HA tag HG15216-NY
RHOJ cDNA ORF Clone, Human, C-Myc tag HG15216-CM
RHOJ cDNA ORF Clone, Human, N-Myc tag HG15216-NM
RHOJ qPCR Primer Pairs, Human HP103842
info info
添加购物车成功! 添加购物车失败!