RHEB cDNA ORF Clone, Human, C-Myc tag

Cat: HG11382-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RHEB Reagents
CRO Services
Product recommended

All RHEB Reagents
RHEB cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
600 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Ras homolog enriched in brain with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+0.6kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RHEB cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RHEB cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
RHEB cDNA ORF Clone, Human, C-Myc tag Alternative Names
RHEB2 cDNA ORF Clone, Human
RHEB Background Information

RHEB is a recently discovered member of the Ras superfamily that may be involved in neural plasticity. This function is novel and not typically associated with the Ras proteins. RHEB gene is a member of the small GTPase superfamily and encodes a lipid-anchored, cell membrane protein with five repeats of the RAS-related GTP-binding region. RHEB is vital in regulation of growth and cell cycle progression due to its role in the insulin / TOR / S6K signaling pathway. The protein has GTPase activity and shuttles between a GDP-bound form and a GTP-bound form, and farnesylation of RHEB is required for this activity. Three pseudogenes have been mapped, two on chromosome 10 and one on chromosome 22.

Full Name
Ras homolog enriched in brain
References
  • Karbowniczek, et al. (2004) Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 279(29):29930-7.
  • Long, et al. (2005) Rheb binds and regulates the mTOR kinase. Curr Biol. 15(8):702-13.
  • Mizuki N, et al. (1996) Isolation of cDNA and genomic clones of a human Ras-related GTP-binding protein gene and its chromosomal localization to the long arm of chromosome 7, 7q36. Genomics. 34(1):114-8.
  • RHEB cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    RHEB cDNA ORF Clone in Cloning Vector, Rhesus CG90714-G
    RHEB cDNA ORF Clone, Rhesus, untagged CG90714-UT
    RHEB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90714-ACGLN
    RHEB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90714-ACG
    RHEB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90714-ACR
    RHEB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90714-CF
    RHEB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90714-NF
    RHEB cDNA ORF Clone, Rhesus, C-His tag CG90714-CH
    RHEB cDNA ORF Clone, Rhesus, N-His tag CG90714-NH
    RHEB cDNA ORF Clone, Rhesus, C-HA tag CG90714-CY
    RHEB cDNA ORF Clone, Rhesus, N-HA tag CG90714-NY
    RHEB cDNA ORF Clone, Rhesus, C-Myc tag CG90714-CM
    RHEB cDNA ORF Clone, Rhesus, N-Myc tag CG90714-NM

    RHEB cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RHEB cDNA ORF Clone in Cloning Vector, Rat RG81447-G

    RHEB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RHEB cDNA ORF Clone in Cloning Vector, Mouse MG53226-G
    RHEB cDNA ORF Clone, Mouse, untagged MG53226-UT
    RHEB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53226-ACG
    RHEB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53226-ACGLN
    RHEB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53226-ACR
    RHEB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53226-CF
    RHEB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53226-NF
    RHEB cDNA ORF Clone, Mouse, C-His tag MG53226-CH
    RHEB cDNA ORF Clone, Mouse, N-His tag MG53226-NH
    RHEB cDNA ORF Clone, Mouse, C-HA tag MG53226-CY
    RHEB cDNA ORF Clone, Mouse, N-HA tag MG53226-NY
    RHEB cDNA ORF Clone, Mouse, C-Myc tag MG53226-CM
    RHEB cDNA ORF Clone, Mouse, N-Myc tag MG53226-NM

    RHEB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RHEB cDNA ORF Clone in Cloning Vector, Human HG11382-M
    RHEB cDNA ORF Clone, Human, untagged HG11382-UT
    RHEB cDNA ORF Clone, Human, C-GFPSpark® tag HG11382-ACG
    RHEB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11382-ACGLN
    RHEB cDNA ORF Clone, Human, C-OFPSpark® tag HG11382-ACR
    RHEB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11382-CF
    RHEB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11382-NF
    RHEB cDNA ORF Clone, Human, C-His tag HG11382-CH
    RHEB cDNA ORF Clone, Human, N-His tag HG11382-NH
    RHEB cDNA ORF Clone, Human, C-HA tag HG11382-CY
    RHEB cDNA ORF Clone, Human, N-HA tag HG11382-NY
    RHEB cDNA ORF Clone, Human, N-Myc tag HG11382-NM
    RHEB qPCR Primer Pairs, Human HP101261
    info info
    添加购物车成功! 添加购物车失败!