RGS5 cDNA ORF Clone, Human, C-His tag

Cat: HG15234-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RGS5 Reagents
CRO Services
Product recommended

All RGS5 Reagents
RGS5 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Human regulator of G-protein signaling 5 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RGS5 cDNA ORF Clone, Human, C-His tag Alternative Names
MST092 cDNA ORF Clone, Human;MST106 cDNA ORF Clone, Human;MST129 cDNA ORF Clone, Human;MSTP032 cDNA ORF Clone, Human;MSTP092 cDNA ORF Clone, Human;MSTP106 cDNA ORF Clone, Human;MSTP129 cDNA ORF Clone, Human;RGS5 cDNA ORF Clone, Human
RGS5 Background Information
Full Name
regulator of G-protein signaling 5

RGS5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
RGS5 cDNA ORF Clone in Cloning Vector, Rhesus CG90371-G
RGS5 cDNA ORF Clone, Rhesus, untagged CG90371-UT
RGS5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90371-ACG
RGS5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90371-ACGLN
RGS5 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90371-ANG
RGS5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90371-ACR
RGS5 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90371-ANR
RGS5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90371-CF
RGS5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90371-NF
RGS5 cDNA ORF Clone, Rhesus, C-His tag CG90371-CH
RGS5 cDNA ORF Clone, Rhesus, N-His tag CG90371-NH
RGS5 cDNA ORF Clone, Rhesus, C-HA tag CG90371-CY
RGS5 cDNA ORF Clone, Rhesus, N-HA tag CG90371-NY
RGS5 cDNA ORF Clone, Rhesus, C-Myc tag CG90371-CM
RGS5 cDNA ORF Clone, Rhesus, N-Myc tag CG90371-NM

RGS5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RGS5 cDNA ORF Clone in Cloning Vector, Rat RG81507-G

RGS5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RGS5 cDNA ORF Clone in Cloning Vector, Mouse MG58346-U
RGS5 cDNA ORF Clone, Mouse, untagged MG58346-UT
RGS5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58346-ACG
RGS5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58346-ACGLN
RGS5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58346-ANG
RGS5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58346-ACR
RGS5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58346-ANR
RGS5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58346-CF
RGS5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58346-NF
RGS5 cDNA ORF Clone, Mouse, C-His tag MG58346-CH
RGS5 cDNA ORF Clone, Mouse, N-His tag MG58346-NH
RGS5 cDNA ORF Clone, Mouse, C-HA tag MG58346-CY
RGS5 cDNA ORF Clone, Mouse, N-HA tag MG58346-NY
RGS5 cDNA ORF Clone, Mouse, C-Myc tag MG58346-CM
RGS5 cDNA ORF Clone, Mouse, N-Myc tag MG58346-NM

RGS5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RGS5 cDNA ORF Clone in Cloning Vector, Human HG15234-G
RGS5 cDNA ORF Clone, Human, untagged HG15234-UT
RGS5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15234-ACG
RGS5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15234-ACGLN
RGS5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15234-ANG
RGS5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15234-ACR
RGS5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15234-ANR
RGS5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15234-CF
RGS5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15234-NF
RGS5 cDNA ORF Clone, Human, N-His tag HG15234-NH
RGS5 cDNA ORF Clone, Human, C-HA tag HG15234-CY
RGS5 cDNA ORF Clone, Human, N-HA tag HG15234-NY
RGS5 cDNA ORF Clone, Human, C-Myc tag HG15234-CM
RGS5 cDNA ORF Clone, Human, N-Myc tag HG15234-NM
RGS5 qPCR Primer Pairs, Human HP103860
info info
添加购物车成功! 添加购物车失败!