Quick Order

Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human RGS5 cDNA Clone Product Information
    NCBI RefSeq:BC030059
    RefSeq ORF Size:546bp
    cDNA Description:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 5 DNA.
    Gene Synonym:MST092, MST106, MST129, MSTP032, MSTP092, MSTP106, MSTP129
    Species:Human
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RGS5 qPCR primers for gene expression analysis, HP103860 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid on other vectors
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG15234-ACG$225
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG15234-ACR$225
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG15234-ANG$225
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG15234-ANR$225
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Flag tagHG15234-CF$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-His tagHG15234-CH$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-Myc tagHG15234-CM$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, C-HA tagHG15234-CY$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone in cloning vectorHG15234-G$75
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Flag tagHG15234-NF$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-His tagHG15234-NH$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-Myc tagHG15234-NM$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmid, N-HA tagHG15234-NY$195
    Human RGS5 / Regulator of G-protein signaling 5 Gene ORF cDNA clone expression plasmidHG15234-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"