RFK cDNA ORF Clone, Human, N-Myc tag

Cat: HG13881-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RFK Reagents
CRO Services
Product recommended

All RFK Reagents
RFK cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
489 bp
Description
Full length Clone DNA of Human riboflavin kinase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RFK cDNA ORF Clone, Human, N-Myc tag Alternative Names
RIFK cDNA ORF Clone, Human
RFK Background Information

Flavokinase is a member of the transferases family, specifically those transferring phosphorus-containing groups (phosphotransferases) with an alcohol group as acceptor. Flavokinase is an essential enzyme that catalyzes the phosphorylation of riboflavin (vitamin B2) to form flavin mononucleotide (FMN), an obligatory step in vitamin B2 utilization and flavin cofactor synthesis. It has been proposed that TNF, through the activation of the flavokinase gene, enhances the incorporation of FAD in NADPH oxidase enzymes, which is a critical step for the assembly and activation of NADPH oxidase.

Full Name
riboflavin kinase
References
  • Hirano G, et al. (2011) Involvement of riboflavin kinase expression in cellular sensitivity against cisplatin. Int J Oncol. 38(4):893-902.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • RFK cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RFK cDNA ORF Clone in Cloning Vector, Mouse MG53707-U
    RFK cDNA ORF Clone, Mouse, untagged MG53707-UT
    RFK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53707-ACGLN
    RFK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53707-ACG
    RFK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53707-ANG
    RFK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53707-ACR
    RFK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53707-ANR
    RFK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53707-CF
    RFK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53707-NF
    RFK cDNA ORF Clone, Mouse, C-His tag MG53707-CH
    RFK cDNA ORF Clone, Mouse, N-His tag MG53707-NH
    RFK cDNA ORF Clone, Mouse, C-HA tag MG53707-CY
    RFK cDNA ORF Clone, Mouse, N-HA tag MG53707-NY
    RFK cDNA ORF Clone, Mouse, C-Myc tag MG53707-CM
    RFK cDNA ORF Clone, Mouse, N-Myc tag MG53707-NM

    RFK cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RFK cDNA ORF Clone in Cloning Vector, Human HG13881-G
    RFK cDNA ORF Clone, Human, untagged HG13881-UT
    RFK cDNA ORF Clone, Human, C-GFPSpark® tag HG13881-ACG
    RFK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13881-ACGLN
    RFK cDNA ORF Clone, Human, N-GFPSpark® tag HG13881-ANG
    RFK cDNA ORF Clone, Human, C-OFPSpark® tag HG13881-ACR
    RFK cDNA ORF Clone, Human, N-OFPSpark® tag HG13881-ANR
    RFK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13881-CF
    RFK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13881-NF
    RFK cDNA ORF Clone, Human, C-His tag HG13881-CH
    RFK cDNA ORF Clone, Human, N-His tag HG13881-NH
    RFK cDNA ORF Clone, Human, C-HA tag HG13881-CY
    RFK cDNA ORF Clone, Human, N-HA tag HG13881-NY
    RFK cDNA ORF Clone, Human, C-Myc tag HG13881-CM
    RFK qPCR Primer Pairs, Human HP102572
    info info
    添加购物车成功! 添加购物车失败!