RET cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11997-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RET Reagents
CRO Services
Product recommended

All RET Reagents
RET cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3384 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ret proto-oncogene, transcript variant 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + NotI(6kb+3.38kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RET cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RET cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human STAT3 Gene Plasmid Map 5680
RET cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CDHF12 cDNA ORF Clone, Human;CDHR16 cDNA ORF Clone, Human;HSCR1 cDNA ORF Clone, Human;MEN2A cDNA ORF Clone, Human;MEN2B cDNA ORF Clone, Human;MTC1 cDNA ORF Clone, Human;PTC cDNA ORF Clone, Human;RET-ELE1 cDNA ORF Clone, Human;RET51 cDNA ORF Clone, Human
RET Background Information

RET proto-oncogene, also known as RET, is a cell-surface molecule that transduce signals for cell growth and differentiation. It contains 1 cadherin domain and 1 protein kinase domain. RET proto-oncogene belongs to the protein kinase superfamily, tyr protein kinase family. RET proto-oncogene is involved in numerous cellular mechanisms including cell proliferation, neuronal navigation, cell migration, and cell differentiation upon binding with glial cell derived neurotrophic factor family ligands. It phosphorylates PTK2/FAK1 and regulates both cell death/survival balance and positional information. RET is required for the molecular mechanisms orchestration during intestine organogenesis; involved in the development of enteric nervous system and renal organogenesis during embryonic life; promotes the formation of Peyer's patch-like structures; modulates cell adhesion via its cleavage; involved in the development of the neural crest. RET proto-oncogene is active in the absence of ligand, triggering apoptosis. RET acts as a dependence receptor; in the presence of the ligand GDNF in somatotrophs (within pituitary), promotes survival and down regulates growth hormone (GH) production, but triggers apoptosis in absence of GDNF. It also regulates nociceptor survival and size; triggers the differentiation of rapidly adapting (RA) mechanoreceptors; mediated several diseases such as neuroendocrine cancers. Defects in RET may cause colorectal cancer, hirschsprung disease type 1, medullary thyroid carcinoma, multiple neoplasia type 2B, susceptibility to pheochromocytoma, multiple neoplasia type 2A, thyroid papillary carcinoma and congenital central hypoventilation syndrome.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
ret proto-oncogene
References
  • Schulten HJ, et al. (2011) Mutational screening of RET, HRAS, KRAS, NRAS, BRAF, AKT1, and CTNNB1 in medullary thyroid carcinoma. Anticancer Res. 31(12):4179-83.
  • Ciampi R, et al. (2012) Chromosome 10 and RET gene copy number alterations in hereditary and sporadic Medullary Thyroid Carcinoma. Mol Cell Endocrinol. 348(1):176-82.
  • Garcia-Lavandeira M, et al. (2012) Craniopharyngiomas express embryonic stem cell markers (SOX2, OCT4, KLF4, and SOX9) as pituitary stem cells but do not coexpress RET/GFRA3 receptors. J Clin Endocrinol Metab. 97(1):E80-7.
  • Stine ZE, et al. (2011) Steroid hormone modulation of RET through two estrogen responsive enhancers in breast cancer. Hum Mol Genet. 20(19):3746-56.
  • Sharma BP, et al. (2011) RET gene mutations and polymorphisms in medullary thyroid carcinomas in Indian patients. J Biosci. 36(4):603-11.
  • info info
    添加购物车成功! 添加购物车失败!