Text Size:AAA

Human Renin Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human REN cDNA Clone Product Information
    NCBI RefSeq:NM_000537.3
    RefSeq ORF Size:1221bp
    cDNA Description:Full length Clone DNA of Homo sapiens rennin with C terminal HA tag.
    Gene Synonym:FLJ10761
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REN qPCR primers for gene expression analysis, HP100053 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Renin-1, also known as Ren-1, Angiotensinogenase and Kidney renin, is a member of the peptidase A1 family. Renin-1 is synthesized by the juxtaglomerular cells of the kidney in response to decreased blood pressure and sodium concentration. androgen and thyroid hormones influence levels of Renin-1 in mouse submandibular gland (SMG) primarily by regulating the amount of Renin-1 mRNA available for translation. Renin-1 is a highly specific endopeptidase, whose only known function is to generate angiotensin I from angiotensinogen in the plasma, initiating a cascade of reactions that produce an elevation of blood pressure and increased sodium retention by the kidney. It is expressed at relatively low levels in mouse SMG and kidney. Ren-2 is expressed at high levels in the mouse SMG and at very low levels, if at all, in the kidney. Ren-1 and Ren-2 are closely linked on mouse chromosome 1, show extensive homology in coding and noncoding regions and provide a model for studying the regulation of gene expression.

    Size / Price
    Catalog: HG10969-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"