Quick Order

Human RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

  • Human RELA / Transcription factor p65 / NFkB p65 natural ORF mammalian expression plasmid, C-GFPSpark tag
  • Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
DatasheetReviewsRelated ProductsProtocols
Human RELA cDNA Clone Product Information
NCBI RefSeq:NM_021975
RefSeq ORF Size:1656bp
cDNA Description:Full length Clone DNA of Homo sapiens v-rel reticuloendotheliosis viral oncogene homolog A (avian) with C terminal GFPSpark tag.
Gene Synonym:p65
Species:Human
Vector:pCMV3-C-GFPSpark
Plasmid:pCMV3-RELA-GFPSpark
Restriction Site:KpnI + XbaI (6kb + 2.39kb)
Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RELA qPCR primers for gene expression analysis, HP100039 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RELA Gene Plasmid Map
Human RELA / Transcription factor p65 / NFkB p65 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-tagged
Human RELA Gene Expression validated Image
Human RELA / Transcription factor p65 / NFkB p65 natural ORF mammalian expression plasmid, C-GFPSpark tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
GFPSpark Tag Info

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Human RELA / Transcription factor p65 Gene ORF cDNA clone expression plasmid, C-GFPSpark tag on other vectors
Product nameProduct name
Background

RELA (v-rel reticuloendotheliosis viral oncogene homolog A), also known as Nuclear factor NF-kappa-B p65 subunit, or Transcription factor p65, is a transcription factor expressed in growth plate chondrocytes where it facilitates chondrogenesis. The v-rel avian reticuloendotheliosis viral oncogene homolog A (RELA) gene encodes the major component of the NF-?B complex. NF-kappaB is a generic name for an evolutionarily conserved transcription-factor system that contributes to the mounting of an effective immune response but is also involved in the regulation of cell proliferation, development, and apoptosis. The implication of NF-kappaB in central biological processes and its extraordinary connectivity to other signaling pathways raise a need for highly controlled regulation of NF-kappaB activity at several levels. The mammalian Rel/NF-kappaB family of transcription factors, including RelA, c-Rel, RelB, NF-kappaB1 (p50 and its precursor p105), and NF-kappaB2 (p52 and its precursor p100), plays a central role in the immune system by regulating several processes ranging from the development and survival of lymphocytes and lymphoid organs to the control of immune responses and malignant transformation.

References
  • Hashimoto R, et al. (2011) Variants of the RELA gene are associated with schizophrenia and their startle responses. Neuropsychopharmacology. 36(9): 1921-31.
  • Vallabhapurapu S, et al. (2009) Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol. 27: 693-733.
  • Schmitz ML, et al. (2004) NF-kappaB: a multifaceted transcription factor regulated at several levels. Chembiochem. 5(10): 1348-58.
  • Size / Price
    Catalog: HG12054-ACG
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"