Quick Order

Human REG1A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human REG1A cDNA Clone Product Information
NCBI RefSeq:NM_002909.4
RefSeq ORF Size:501bp
cDNA Description:Full length Clone DNA of Homo sapiens regenerating islet-derived 1 alpha.
Gene Synonym:P19, PSP, PTP, REG, ICRF, PSPS, PSPS1, MGC12447, REG1A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-REG1A
Restriction Site:KpnI + XbaI (6.1kb + 0.5kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human REG1A Gene Plasmid Map
Human REG1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Regenerating (reg) gene encodes protein that has been involved in pancreatic lithogenesis and the regeneration of islet cells and therefore the abnormality of reg genes could be associated with fibrocalculous pancreatopathy. REG I has been shown to be crucial for induction of ductal epithelial cells to differentiate into some cells. Lithostathine-1-alpha, also known as Pancreatic stone protein, Pancreatic thread protein, Regenerating islet-derived protein 1-alpha, REG1A, REG-1-alpha, and PSPS, is highly expressed in fetal and infant brains. REG1A contains one C-type lectin domain and is a known growth factor affecting pancreatic islet beta cells. REG1A may act as an inhibitor of spontaneous calcium carbonate precipitation. It may also be associated with neuronal sprouting in brain, and with brain and pancreas regeneration. REG1A has been reported to be expressed in human cancers, and it may be positively correlated with patient's prognosis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. High levels of REG1A expression by tumor cells are an independent predictor of a poor prognosis in patients with non-small cell lung cancer (NSCLC).

References
  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Tezel E, et al. (2004) REG I as a marker for human pancreatic acinoductular cells. Hepatogastroenterology. 51(55): 91-6.
  • Geng J, et al. (2009) REG1A predicts recurrence in stage Ta/T1 bladder cancer. Eur J Surg Oncol. 35(8): 852-7.
  • Size / Price
    Catalog: HG11234-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human REG1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"