Reticulocalbin 3 cDNA ORF Clone, Human, N-HA tag

Cat: HG13533-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Reticulocalbin 3 Reagents
CRO Services
Product recommended

All Reticulocalbin 3 Reagents
Reticulocalbin 3 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
987 bp
Description
Full length Clone DNA of Human reticulocalbin 3, EF-hand calcium binding domain with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Reticulocalbin 3 cDNA ORF Clone, Human, N-HA tag Alternative Names
RLP49 cDNA ORF Clone, Human
Reticulocalbin 3 Background Information

RCN3 belongs to the CREC family which contains multiple EF-hand Ca2+-binding proteins localized to the secretory pathway. RCN3 sequence is characterized by the presence of five Arg-Xaa-Xaa-Arg motifs, which represents the target sequence of subtilisin-like proprotein convertases(SPCs). SPCs are a family of seven structurally related serine endoproteases that are involved in the proteolytic activation of proproteins.RCN3 is transiently associated with proPACE4, but not with mature PACE4. Inhibition of PACE4 maturation by a Ca2+ ionophore resulted in accumulation of the proPACE4-RCN-3 complex in cells. It has been proposed that elective and transient association of RCN3 with the precursor of PACE4 plays an important role in the biosynthesis of PACE4.

Full Name
reticulocalbin 3, EF-hand calcium binding domain
References
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Kamatani Y, et al. (2010) Genome-wide association study of hematological and biochemical traits in a Japanese population. Nat Genet. 42(3):210-5.
  • Reticulocalbin 3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Reticulocalbin 3 cDNA ORF Clone in Cloning Vector, Rat RG80877-U
    Reticulocalbin 3 cDNA ORF Clone, Rat, untagged RG80877-UT
    Reticulocalbin 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80877-ACGLN
    Reticulocalbin 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80877-ACG
    Reticulocalbin 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80877-ACR
    Reticulocalbin 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80877-CF
    Reticulocalbin 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80877-NF
    Reticulocalbin 3 cDNA ORF Clone, Rat, C-His tag RG80877-CH
    Reticulocalbin 3 cDNA ORF Clone, Rat, N-His tag RG80877-NH
    Reticulocalbin 3 cDNA ORF Clone, Rat, C-HA tag RG80877-CY
    Reticulocalbin 3 cDNA ORF Clone, Rat, N-HA tag RG80877-NY
    Reticulocalbin 3 cDNA ORF Clone, Rat, C-Myc tag RG80877-CM
    Reticulocalbin 3 cDNA ORF Clone, Rat, N-Myc tag RG80877-NM
    Reticulocalbin 3 qPCR Primer Pairs, Rat RP300841

    Reticulocalbin 3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Reticulocalbin 3 cDNA ORF Clone in Cloning Vector, Mouse MG51928-G
    Reticulocalbin 3 cDNA ORF Clone, Mouse, untagged MG51928-UT
    Reticulocalbin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51928-ACG
    Reticulocalbin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51928-ACGLN
    Reticulocalbin 3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51928-ANG
    Reticulocalbin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51928-ACR
    Reticulocalbin 3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51928-ANR
    Reticulocalbin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51928-CF
    Reticulocalbin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51928-NF
    Reticulocalbin 3 cDNA ORF Clone, Mouse, C-His tag MG51928-CH
    Reticulocalbin 3 cDNA ORF Clone, Mouse, N-His tag MG51928-NH
    Reticulocalbin 3 cDNA ORF Clone, Mouse, C-HA tag MG51928-CY
    Reticulocalbin 3 cDNA ORF Clone, Mouse, N-HA tag MG51928-NY
    Reticulocalbin 3 cDNA ORF Clone, Mouse, C-Myc tag MG51928-CM
    Reticulocalbin 3 cDNA ORF Clone, Mouse, N-Myc tag MG51928-NM
    Reticulocalbin 3 qPCR Primer Pairs, Mouse MP201801

    Reticulocalbin 3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Reticulocalbin 3 cDNA ORF Clone in Cloning Vector, Human HG13533-G
    Reticulocalbin 3 cDNA ORF Clone, Human, untagged HG13533-UT
    Reticulocalbin 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13533-ACG
    Reticulocalbin 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13533-ACGLN
    Reticulocalbin 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13533-ACR
    Reticulocalbin 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13533-CF
    Reticulocalbin 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13533-NF
    Reticulocalbin 3 cDNA ORF Clone, Human, C-His tag HG13533-CH
    Reticulocalbin 3 cDNA ORF Clone, Human, N-His tag HG13533-NH
    Reticulocalbin 3 cDNA ORF Clone, Human, C-HA tag HG13533-CY
    Reticulocalbin 3 cDNA ORF Clone, Human, C-Myc tag HG13533-CM
    Reticulocalbin 3 cDNA ORF Clone, Human, N-Myc tag HG13533-NM
    Reticulocalbin 3 qPCR Primer Pairs, Human HP102219
    info info
    添加购物车成功! 添加购物车失败!