Quick Order

Human RCN3 ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human RCN3 cDNA Clone Product Information
NCBI RefSeq:BC013436
RefSeq ORF Size:987bp
cDNA Description:Full length Clone DNA of Homo sapiens reticulocalbin 3, EF-hand calcium binding domain with N terminal HA tag.
Gene Synonym:RLP49, RCN3
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

RCN3 belongs to the CREC family which contains multiple EF-hand Ca2+-binding proteins localized to the secretory pathway. RCN3 sequence is characterized by the presence of five Arg-Xaa-Xaa-Arg motifs, which represents the target sequence of subtilisin-like proprotein convertases(SPCs). SPCs are a family of seven structurally related serine endoproteases that are involved in the proteolytic activation of proproteins.RCN3 is transiently associated with proPACE4, but not with mature PACE4. Inhibition of PACE4 maturation by a Ca2+ ionophore resulted in accumulation of the proPACE4-RCN-3 complex in cells. It has been proposed that elective and transient association of RCN3 with the precursor of PACE4 plays an important role in the biosynthesis of PACE4.

References
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Kamatani Y, et al. (2010) Genome-wide association study of hematological and biochemical traits in a Japanese population. Nat Genet. 42(3):210-5.
  • Size / Price
    Catalog: HG13533-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"