RBX1 cDNA ORF Clone, Human, untagged

Cat: HG14319-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RBX1 Reagents
CRO Services
Product recommended

All RBX1 Reagents
RBX1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
327 bp
Description
Full length Clone DNA of Human ring-box 1, E3 ubiquitin protein ligase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBX1 cDNA ORF Clone, Human, untagged Alternative Names
BA554C12.1 cDNA ORF Clone, Human;RNF75 cDNA ORF Clone, Human;ROC1 cDNA ORF Clone, Human
RBX1 Background Information
Full Name
ring-box 1, E3 ubiquitin protein ligase

RBX1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RBX1 cDNA ORF Clone in Cloning Vector, Rat RG81281-U
RBX1 cDNA ORF Clone, Rat, untagged RG81281-UT
RBX1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81281-ACG
RBX1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81281-ACGLN
RBX1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81281-ANG
RBX1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81281-ACR
RBX1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81281-ANR
RBX1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81281-CF
RBX1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81281-NF
RBX1 cDNA ORF Clone, Rat, C-His tag RG81281-CH
RBX1 cDNA ORF Clone, Rat, N-His tag RG81281-NH
RBX1 cDNA ORF Clone, Rat, C-HA tag RG81281-CY
RBX1 cDNA ORF Clone, Rat, N-HA tag RG81281-NY
RBX1 cDNA ORF Clone, Rat, C-Myc tag RG81281-CM
RBX1 cDNA ORF Clone, Rat, N-Myc tag RG81281-NM
RBX1 qPCR Primer Pairs, Rat RP301237

RBX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RBX1 cDNA ORF Clone in Cloning Vector, Mouse MG51611-U
RBX1 cDNA ORF Clone, Mouse, untagged MG51611-UT
RBX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51611-ACGLN
RBX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51611-ACG
RBX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51611-ANG
RBX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51611-ACR
RBX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51611-ANR
RBX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51611-CF
RBX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51611-NF
RBX1 cDNA ORF Clone, Mouse, C-His tag MG51611-CH
RBX1 cDNA ORF Clone, Mouse, N-His tag MG51611-NH
RBX1 cDNA ORF Clone, Mouse, C-HA tag MG51611-CY
RBX1 cDNA ORF Clone, Mouse, N-HA tag MG51611-NY
RBX1 cDNA ORF Clone, Mouse, C-Myc tag MG51611-CM
RBX1 cDNA ORF Clone, Mouse, N-Myc tag MG51611-NM
RBX1 qPCR Primer Pairs, Mouse MP201278

RBX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RBX1 cDNA ORF Clone in Cloning Vector, Human HG14319-G
RBX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14319-ACGLN
RBX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14319-ACG
RBX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14319-ANG
RBX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14319-ACR
RBX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14319-ANR
RBX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14319-CF
RBX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14319-NF
RBX1 cDNA ORF Clone, Human, C-His tag HG14319-CH
RBX1 cDNA ORF Clone, Human, N-His tag HG14319-NH
RBX1 cDNA ORF Clone, Human, C-HA tag HG14319-CY
RBX1 cDNA ORF Clone, Human, N-HA tag HG14319-NY
RBX1 cDNA ORF Clone, Human, C-Myc tag HG14319-CM
RBX1 cDNA ORF Clone, Human, N-Myc tag HG14319-NM
RBX1 qPCR Primer Pairs, Human HP102969
info info
添加购物车成功! 添加购物车失败!