RBPJ cDNA ORF Clone, Human, N-His tag

Cat: HG13113-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RBPJ Reagents
CRO Services
Product recommended

All RBPJ Reagents
RBPJ cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1503 bp
Description
Full length Clone DNA of Human recombination signal binding protein for immunoglobulin kappa J region with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RBPJ cDNA ORF Clone, Human, N-His tag Alternative Names
AOS3 cDNA ORF Clone, Human;CBF1 cDNA ORF Clone, Human;csl cDNA ORF Clone, Human;IGKJRB cDNA ORF Clone, Human;IGKJRB1 cDNA ORF Clone, Human;KBF2 cDNA ORF Clone, Human;RBP-J cDNA ORF Clone, Human;RBPJK cDNA ORF Clone, Human;RBPSUH cDNA ORF Clone, Human;SUH cDNA ORF Clone, Human
RBPJ Background Information
Full Name
recombination signal binding protein for immunoglobulin kappa J region

RBPJ cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RBPJ cDNA ORF Clone in Cloning Vector, Rat RG84576-U
RBPJ Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84576-ACGLN

RBPJ cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RBPJ cDNA ORF Clone in Cloning Vector, Mouse MG52786-G
RBPJ cDNA ORF Clone, Mouse, untagged MG52786-UT
RBPJ Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52786-ACGLN
RBPJ cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52786-ACG
RBPJ cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52786-ANG
RBPJ cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52786-ACR
RBPJ cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52786-ANR
RBPJ cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52786-CF
RBPJ cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52786-NF
RBPJ cDNA ORF Clone, Mouse, C-His tag MG52786-CH
RBPJ cDNA ORF Clone, Mouse, N-His tag MG52786-NH
RBPJ cDNA ORF Clone, Mouse, C-HA tag MG52786-CY
RBPJ cDNA ORF Clone, Mouse, N-HA tag MG52786-NY
RBPJ cDNA ORF Clone, Mouse, C-Myc tag MG52786-CM
RBPJ cDNA ORF Clone, Mouse, N-Myc tag MG52786-NM

RBPJ cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RBPJ cDNA ORF Clone in Cloning Vector, Human HG15475-G
RBPJ cDNA ORF Clone in Cloning Vector, Human HG13113-G
RBPJ cDNA ORF Clone, Human, untagged HG13113-UT
RBPJ cDNA ORF Clone, Human, untagged HG15475-UT
RBPJ cDNA ORF Clone, Human, C-GFPSpark® tag HG15475-ACG
RBPJ Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13113-ACGLN
RBPJ Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15475-ACGLN
RBPJ cDNA ORF Clone, Human, C-GFPSpark® tag HG13113-ACG
RBPJ cDNA ORF Clone, Human, N-GFPSpark® tag HG13113-ANG
RBPJ cDNA ORF Clone, Human, N-GFPSpark® tag HG15475-ANG
RBPJ cDNA ORF Clone, Human, C-OFPSpark® tag HG13113-ACR
RBPJ cDNA ORF Clone, Human, C-OFPSpark® tag HG15475-ACR
RBPJ cDNA ORF Clone, Human, N-OFPSpark® tag HG15475-ANR
RBPJ cDNA ORF Clone, Human, N-OFPSpark® tag HG13113-ANR
RBPJ cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13113-CF
RBPJ cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15475-CF
RBPJ cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15475-NF
RBPJ cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13113-NF
RBPJ cDNA ORF Clone, Human, C-His tag HG13113-CH
RBPJ cDNA ORF Clone, Human, C-His tag HG15475-CH
RBPJ cDNA ORF Clone, Human, N-His tag HG15475-NH
RBPJ cDNA ORF Clone, Human, C-HA tag HG15475-CY
RBPJ cDNA ORF Clone, Human, C-HA tag HG13113-CY
RBPJ cDNA ORF Clone, Human, N-HA tag HG15475-NY
RBPJ cDNA ORF Clone, Human, N-HA tag HG13113-NY
RBPJ cDNA ORF Clone, Human, C-Myc tag HG15475-CM
RBPJ cDNA ORF Clone, Human, C-Myc tag HG13113-CM
RBPJ cDNA ORF Clone, Human, N-Myc tag HG13113-NM
RBPJ cDNA ORF Clone, Human, N-Myc tag HG15475-NM
RBPJ qPCR Primer Pairs, Human HP101735
info info
添加购物车成功! 添加购物车失败!