RASGRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13939-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RASGRF1 Reagents
CRO Services
Product recommended

All RASGRF1 Reagents
RASGRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3546 bp
Description
Full length Clone DNA of Human Ras protein-specific guanine nucleotide-releasing factor 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RASGRF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CDC25 cDNA ORF Clone, Human;CDC25L cDNA ORF Clone, Human;GNRP cDNA ORF Clone, Human;GRF1 cDNA ORF Clone, Human;GRF55 cDNA ORF Clone, Human;H-GRF55 cDNA ORF Clone, Human;PP13187 cDNA ORF Clone, Human;ras-GRF1 cDNA ORF Clone, Human
RASGRF1 Background Information
Full Name
Ras protein-specific guanine nucleotide-releasing factor 1

RASGRF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RASGRF1 cDNA ORF Clone in Cloning Vector, Mouse MG51615-G
RASGRF1 cDNA ORF Clone, Mouse, untagged MG51615-UT
RASGRF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51615-ACGLN
RASGRF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51615-ACG
RASGRF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51615-ANG
RASGRF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51615-ACR
RASGRF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51615-ANR
RASGRF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51615-CF
RASGRF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51615-NF
RASGRF1 cDNA ORF Clone, Mouse, C-His tag MG51615-CH
RASGRF1 cDNA ORF Clone, Mouse, N-His tag MG51615-NH
RASGRF1 cDNA ORF Clone, Mouse, C-HA tag MG51615-CY
RASGRF1 cDNA ORF Clone, Mouse, N-HA tag MG51615-NY
RASGRF1 cDNA ORF Clone, Mouse, C-Myc tag MG51615-CM
RASGRF1 cDNA ORF Clone, Mouse, N-Myc tag MG51615-NM
RASGRF1 qPCR Primer Pairs, Mouse MP201488

RASGRF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RASGRF1 cDNA ORF Clone in Cloning Vector, Human HG13939-G
RASGRF1 cDNA ORF Clone, Human, untagged HG13939-UT
RASGRF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13939-ACG
RASGRF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13939-ACGLN
RASGRF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13939-ANG
RASGRF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13939-ACR
RASGRF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13939-ANR
RASGRF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13939-NF
RASGRF1 cDNA ORF Clone, Human, C-His tag HG13939-CH
RASGRF1 cDNA ORF Clone, Human, N-His tag HG13939-NH
RASGRF1 cDNA ORF Clone, Human, C-HA tag HG13939-CY
RASGRF1 cDNA ORF Clone, Human, N-HA tag HG13939-NY
RASGRF1 cDNA ORF Clone, Human, C-Myc tag HG13939-CM
RASGRF1 cDNA ORF Clone, Human, N-Myc tag HG13939-NM
RASGRF1 qPCR Primer Pairs, Human HP102597
info info
添加购物车成功! 添加购物车失败!