RAP1B cDNA ORF Clone, Human, N-HA tag

Cat: HG14667-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAP1B Reagents
CRO Services
Product recommended

All RAP1B Reagents
RAP1B cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human RAP1B, member of RAS oncogene family with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Restriction Sites
KpnI + XbaI(6kb+0.6kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RAP1B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAP1B cDNA ORF Clone, Human, N-HA tag Validated Images
Cynomolgus LOC101926731 Gene Plasmid Map 5628
RAP1B cDNA ORF Clone, Human, N-HA tag Alternative Names
K-REV cDNA ORF Clone, Human;RAL1B cDNA ORF Clone, Human
RAP1B Background Information
Full Name
RAP1B, member of RAS oncogene family

RAP1B cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RAP1B cDNA ORF Clone in Cloning Vector, Ferret FG60045-G
RAP1B cDNA ORF Clone, Ferret, untagged FG60045-UT
RAP1B cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60045-ACG
RAP1B Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60045-ACGLN
RAP1B cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60045-ANG
RAP1B cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60045-ACR
RAP1B cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60045-ANR
RAP1B cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60045-CF
RAP1B cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60045-NF
RAP1B cDNA ORF Clone, Ferret, C-His tag FG60045-CH
RAP1B cDNA ORF Clone, Ferret, N-His tag FG60045-NH
RAP1B cDNA ORF Clone, Ferret, C-HA tag FG60045-CY
RAP1B cDNA ORF Clone, Ferret, N-HA tag FG60045-NY
RAP1B cDNA ORF Clone, Ferret, C-Myc tag FG60045-CM
RAP1B cDNA ORF Clone, Ferret, N-Myc tag FG60045-NM

RAP1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAP1B cDNA ORF Clone in Cloning Vector, Rat RG83803-U
RAP1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83803-ACGLN

RAP1B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAP1B cDNA ORF Clone in Cloning Vector, Mouse MG51724-G
RAP1B cDNA ORF Clone, Mouse, untagged MG51724-UT
RAP1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51724-ACG
RAP1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51724-ACGLN
RAP1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51724-ANG
RAP1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51724-ACR
RAP1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51724-ANR
RAP1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51724-CF
RAP1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51724-NF
RAP1B cDNA ORF Clone, Mouse, C-His tag MG51724-CH
RAP1B cDNA ORF Clone, Mouse, N-His tag MG51724-NH
RAP1B cDNA ORF Clone, Mouse, C-HA tag MG51724-CY
RAP1B cDNA ORF Clone, Mouse, N-HA tag MG51724-NY
RAP1B cDNA ORF Clone, Mouse, C-Myc tag MG51724-CM
RAP1B cDNA ORF Clone, Mouse, N-Myc tag MG51724-NM
RAP1B qPCR Primer Pairs, Mouse MP201597

RAP1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAP1B cDNA ORF Clone in Cloning Vector, Human HG14667-G
RAP1B cDNA ORF Clone, Human, untagged HG14667-UT
RAP1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14667-ACGLN
RAP1B cDNA ORF Clone, Human, C-GFPSpark® tag HG14667-ACG
RAP1B cDNA ORF Clone, Human, C-OFPSpark® tag HG14667-ACR
RAP1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14667-CF
RAP1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14667-NF
RAP1B cDNA ORF Clone, Human, C-His tag HG14667-CH
RAP1B cDNA ORF Clone, Human, N-His tag HG14667-NH
RAP1B cDNA ORF Clone, Human, C-HA tag HG14667-CY
RAP1B cDNA ORF Clone, Human, C-Myc tag HG14667-CM
RAP1B cDNA ORF Clone, Human, N-Myc tag HG14667-NM
RAP1B qPCR Primer Pairs, Human HP103301
info info
添加购物车成功! 添加购物车失败!