RAC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG12100-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAC2 Reagents
CRO Services
Product recommended

All RAC2 Reagents
RAC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Human ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
EN-7 cDNA ORF Clone, Human;Gx cDNA ORF Clone, Human;HSPC022 cDNA ORF Clone, Human;p21-Rac2 cDNA ORF Clone, Human
RAC2 Background Information

Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.

Full Name
ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
References
  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • RAC2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    RAC2 cDNA ORF Clone in Cloning Vector, Rat RG80966-U
    RAC2 cDNA ORF Clone, Rat, untagged RG80966-UT
    RAC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80966-ACG
    RAC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80966-ACGLN
    RAC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80966-ANG
    RAC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80966-ACR
    RAC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80966-ANR
    RAC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80966-CF
    RAC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80966-NF
    RAC2 cDNA ORF Clone, Rat, C-His tag RG80966-CH
    RAC2 cDNA ORF Clone, Rat, N-His tag RG80966-NH
    RAC2 cDNA ORF Clone, Rat, C-HA tag RG80966-CY
    RAC2 cDNA ORF Clone, Rat, N-HA tag RG80966-NY
    RAC2 cDNA ORF Clone, Rat, C-Myc tag RG80966-CM
    RAC2 cDNA ORF Clone, Rat, N-Myc tag RG80966-NM
    RAC2 qPCR Primer Pairs, Rat RP300930

    RAC2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RAC2 cDNA ORF Clone in Cloning Vector, Mouse MG52761-G
    RAC2 cDNA ORF Clone, Mouse, untagged MG52761-UT
    RAC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52761-ACG
    RAC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52761-ACGLN
    RAC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52761-ANG
    RAC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52761-ACR
    RAC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52761-ANR
    RAC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52761-CF
    RAC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52761-NF
    RAC2 cDNA ORF Clone, Mouse, C-His tag MG52761-CH
    RAC2 cDNA ORF Clone, Mouse, N-His tag MG52761-NH
    RAC2 cDNA ORF Clone, Mouse, C-HA tag MG52761-CY
    RAC2 cDNA ORF Clone, Mouse, N-HA tag MG52761-NY
    RAC2 cDNA ORF Clone, Mouse, C-Myc tag MG52761-CM
    RAC2 cDNA ORF Clone, Mouse, N-Myc tag MG52761-NM

    RAC2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RAC2 cDNA ORF Clone in Cloning Vector, Human HG12100-G
    RAC2 cDNA ORF Clone, Human, untagged HG12100-UT
    RAC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12100-ACG
    RAC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12100-ACGLN
    RAC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12100-ANG
    RAC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12100-ACR
    RAC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12100-ANR
    RAC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12100-NF
    RAC2 cDNA ORF Clone, Human, C-His tag HG12100-CH
    RAC2 cDNA ORF Clone, Human, N-His tag HG12100-NH
    RAC2 cDNA ORF Clone, Human, C-HA tag HG12100-CY
    RAC2 cDNA ORF Clone, Human, N-HA tag HG12100-NY
    RAC2 cDNA ORF Clone, Human, C-Myc tag HG12100-CM
    RAC2 cDNA ORF Clone, Human, N-Myc tag HG12100-NM
    RAC2 qPCR Primer Pairs, Human HP101628
    info info
    添加购物车成功! 添加购物车失败!