Quick Order

Human RAB5A Gene ORF cDNA clone expression plasmid, C-His tag

  • Human RAB5A ORF mammalian expression plasmid, C-His tag
DatasheetReviewsRelated ProductsProtocols
Human RAB5A cDNA Clone Product Information
NCBI RefSeq:BC001267
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family with C terminal His tag.
Gene Synonym:RAB5, RAB5A
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-Rab5-His
Restriction Site:KpnI + XbaI (6kb + 0.69kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAB5A qPCR primers for gene expression analysis, HP102669 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RAB5A Gene Plasmid Map
Human RAB5A ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG14013-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"