RAB2B cDNA ORF Clone, Human, C-His tag

Cat: HG15290-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB2B Reagents
CRO Services
Product recommended

All RAB2B Reagents
RAB2B cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
651 bp
Description
Full length Clone DNA of Human RAB2B, member RAS oncogene family with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB2B Background Information
Full Name
RAB2B, member RAS oncogene family

RAB2B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB2B cDNA ORF Clone in Cloning Vector, Rat RG81315-U
RAB2B cDNA ORF Clone, Rat, untagged RG81315-UT
RAB2B cDNA ORF Clone, Rat, C-GFPSpark® tag RG81315-ACG
RAB2B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81315-ACGLN
RAB2B cDNA ORF Clone, Rat, C-OFPSpark® tag RG81315-ACR
RAB2B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81315-CF
RAB2B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81315-NF
RAB2B cDNA ORF Clone, Rat, C-His tag RG81315-CH
RAB2B cDNA ORF Clone, Rat, N-His tag RG81315-NH
RAB2B cDNA ORF Clone, Rat, C-HA tag RG81315-CY
RAB2B cDNA ORF Clone, Rat, N-HA tag RG81315-NY
RAB2B cDNA ORF Clone, Rat, C-Myc tag RG81315-CM
RAB2B cDNA ORF Clone, Rat, N-Myc tag RG81315-NM
RAB2B qPCR Primer Pairs, Rat RP301271

RAB2B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB2B cDNA ORF Clone in Cloning Vector, Human HG15290-G
RAB2B cDNA ORF Clone, Human, untagged HG15290-UT
RAB2B cDNA ORF Clone, Human, C-GFPSpark® tag HG15290-ACG
RAB2B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15290-ACGLN
RAB2B cDNA ORF Clone, Human, N-GFPSpark® tag HG15290-ANG
RAB2B cDNA ORF Clone, Human, C-OFPSpark® tag HG15290-ACR
RAB2B cDNA ORF Clone, Human, N-OFPSpark® tag HG15290-ANR
RAB2B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15290-CF
RAB2B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15290-NF
RAB2B cDNA ORF Clone, Human, N-His tag HG15290-NH
RAB2B cDNA ORF Clone, Human, C-HA tag HG15290-CY
RAB2B cDNA ORF Clone, Human, N-HA tag HG15290-NY
RAB2B cDNA ORF Clone, Human, C-Myc tag HG15290-CM
RAB2B cDNA ORF Clone, Human, N-Myc tag HG15290-NM
RAB2B qPCR Primer Pairs, Human HP103916
info info
添加购物车成功! 添加购物车失败!