RAB20 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15240-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB20 Reagents
CRO Services
Product recommended

All RAB20 Reagents
RAB20 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Human RAB20, member RAS oncogene family with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB20 Background Information
Full Name
RAB20, member RAS oncogene family

RAB20 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB20 cDNA ORF Clone in Cloning Vector, Mouse MG53335-U
RAB20 cDNA ORF Clone, Mouse, untagged MG53335-UT
RAB20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53335-ACGLN
RAB20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53335-ACG
RAB20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53335-ACR
RAB20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53335-CF
RAB20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53335-NF
RAB20 cDNA ORF Clone, Mouse, C-His tag MG53335-CH
RAB20 cDNA ORF Clone, Mouse, N-His tag MG53335-NH
RAB20 cDNA ORF Clone, Mouse, C-HA tag MG53335-CY
RAB20 cDNA ORF Clone, Mouse, N-HA tag MG53335-NY
RAB20 cDNA ORF Clone, Mouse, C-Myc tag MG53335-CM
RAB20 cDNA ORF Clone, Mouse, N-Myc tag MG53335-NM

RAB20 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB20 cDNA ORF Clone in Cloning Vector, Human HG15240-G
RAB20 cDNA ORF Clone, Human, untagged HG15240-UT
RAB20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15240-ACGLN
RAB20 cDNA ORF Clone, Human, C-GFPSpark® tag HG15240-ACG
RAB20 cDNA ORF Clone, Human, N-GFPSpark® tag HG15240-ANG
RAB20 cDNA ORF Clone, Human, C-OFPSpark® tag HG15240-ACR
RAB20 cDNA ORF Clone, Human, N-OFPSpark® tag HG15240-ANR
RAB20 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15240-CF
RAB20 cDNA ORF Clone, Human, C-His tag HG15240-CH
RAB20 cDNA ORF Clone, Human, N-His tag HG15240-NH
RAB20 cDNA ORF Clone, Human, C-HA tag HG15240-CY
RAB20 cDNA ORF Clone, Human, N-HA tag HG15240-NY
RAB20 cDNA ORF Clone, Human, C-Myc tag HG15240-CM
RAB20 cDNA ORF Clone, Human, N-Myc tag HG15240-NM
RAB20 qPCR Primer Pairs, Human HP103866
info info
添加购物车成功! 添加购物车失败!