RAB18 cDNA ORF Clone, Human, C-HA tag

Cat: HG14674-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAB18 Reagents
CRO Services
Product recommended

All RAB18 Reagents
RAB18 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Human RAB18, member RAS oncogene family with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB18 cDNA ORF Clone, Human, C-HA tag Alternative Names
RAB18LI1 cDNA ORF Clone, Human;WARBM3 cDNA ORF Clone, Human
RAB18 Background Information
Full Name
RAB18, member RAS oncogene family

RAB18 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB18 cDNA ORF Clone in Cloning Vector, Rat RG81376-G

RAB18 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB18 cDNA ORF Clone in Cloning Vector, Mouse MG51569-G
RAB18 cDNA ORF Clone, Mouse, untagged MG51569-UT
RAB18 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51569-ACGLN
RAB18 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51569-ACG
RAB18 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51569-ACR
RAB18 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51569-CF
RAB18 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51569-NF
RAB18 cDNA ORF Clone, Mouse, C-His tag MG51569-CH
RAB18 cDNA ORF Clone, Mouse, N-His tag MG51569-NH
RAB18 cDNA ORF Clone, Mouse, C-HA tag MG51569-CY
RAB18 cDNA ORF Clone, Mouse, N-HA tag MG51569-NY
RAB18 cDNA ORF Clone, Mouse, C-Myc tag MG51569-CM
RAB18 cDNA ORF Clone, Mouse, N-Myc tag MG51569-NM
RAB18 qPCR Primer Pairs, Mouse MP201452

RAB18 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB18 cDNA ORF Clone in Cloning Vector, Human HG14674-G
RAB18 cDNA ORF Clone, Human, untagged HG14674-UT
RAB18 cDNA ORF Clone, Human, C-GFPSpark® tag HG14674-ACG
RAB18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14674-ACGLN
RAB18 cDNA ORF Clone, Human, C-OFPSpark® tag HG14674-ACR
RAB18 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14674-CF
RAB18 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14674-NF
RAB18 cDNA ORF Clone, Human, C-His tag HG14674-CH
RAB18 cDNA ORF Clone, Human, N-His tag HG14674-NH
RAB18 cDNA ORF Clone, Human, N-HA tag HG14674-NY
RAB18 cDNA ORF Clone, Human, C-Myc tag HG14674-CM
RAB18 cDNA ORF Clone, Human, N-Myc tag HG14674-NM
RAB18 qPCR Primer Pairs, Human HP103308
info info
添加购物车成功! 添加购物车失败!